Highly sensitive and accurate screening of 40 dyes in soft drinks by liquid chromatography–electrospray tandem mass spectrometry

Highly sensitive and accurate screening of 40 dyes in soft drinks by liquid chromatography–electrospray tandem mass spectrometry

Highly sensitive and accurate screening of 40 dyes in soft drinks by liquid chromatography–electrospray tandem mass spectrometry

... appropriate for the screening of illegal dyes in foods Conclusion In summary, by combining SPE cleanup and HPLC-MS/MS, an accurate and highly sensitive method was developed to screen 40 dyes in foods Compared ... samples In China, only 10 dyes are permitted to be added to soft drinks (including Tartrazine, Allura Red AC, Erythrosine, Indigo Carmine, Brillia...

Ngày tải lên: 25/08/2016, 22:30

6 442 2
DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY pdf

DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY pdf

... METHOD 525.2 DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY 1.0 SCOPE AND APPLICATION 1.1 This ... procedures for determination of organic compounds in finished drinking water, source water, or drinking water in any treatment stage The method is appl...

Ngày tải lên: 22/03/2014, 14:20

60 528 0
báo cáo hóa học: " Method optimization and validation for the simultaneous determination of arachidonic acid metabolites in exhaled breath condensate by liquid chromatography-electrospray ionization tandem mass spectrometry" doc

báo cáo hóa học: " Method optimization and validation for the simultaneous determination of arachidonic acid metabolites in exhaled breath condensate by liquid chromatography-electrospray ionization tandem mass spectrometry" doc

... screw-cap vial for HPLC analysis and 100 µL of the working solution of the internal standard were added to each sample Then the samples were vortex mixed and a 900 µL aliquot was injected into the LC/MS/MS ... some of the structural isomers of prostaglandins, which resulted in the same parent-daughter ion transitions The whole analytical run time, including the...

Ngày tải lên: 20/06/2014, 00:20

8 459 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... as an internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized ... position of cleavage sites (vertical arrows, a1 a3 ) and cleavage fragments (horizontal double arrows, A1 A5 ) in the sequence of insulin chain A (B) Change over time in...

Ngày tải lên: 23/03/2014, 09:20

11 425 0
Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

... pumping of the agents out of the cells and their passive uptake [10,31] and (b) competition between the active pumping of the agents out of the cells and their intracellular binding to receptors and ... allowing the enhanced uptake of rhodamine dyes inhibited the efflux of these dyes from the cells The efflux of rhodamine 123 and TMRM was inhibited by NBD...

Ngày tải lên: 18/02/2014, 13:20

12 651 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelof...

Ngày tải lên: 10/08/2014, 21:23

7 436 0
báo cáo khoa học: " Rapid and accurate pyrosequencing of angiosperm plastid genomes" doc

báo cáo khoa học: " Rapid and accurate pyrosequencing of angiosperm plastid genomes" doc

... Other ycf Pseudogene Figure Plastid genome map of Nandina domestica (Berberidaceae) Plastid genome map of Nandina domestica (Berberidaceae) Map of the plastid genome of Nandina domestica (Berberidaceae), ... (32 bp and 27 bp gaps, respectively) of each genome Genome characteristics The plastid genomes of both Nandina and Platanus possess the typical genome structure ob...

Ngày tải lên: 12/08/2014, 05:20

13 241 0
Báo cáo y học: "IA simple, fast, and accurate method of phylogenomic inference" docx

Báo cáo y học: "IA simple, fast, and accurate method of phylogenomic inference" docx

... performance of the phylogeny based and the similarity based phylotyping, we carried out a simulation study We determined the sensitivity and specificity of the taxonomic assignments made by AMPHORA and ... 0.1 0.1 0 phylum class order family genus species phylum class order family genus species Figure Comparison of the phylotyping performance by AMPHORA and MEGAN Comparison of...

Ngày tải lên: 14/08/2014, 21:20

11 453 0
Fast and accurate mapping of next generation sequencing data

Fast and accurate mapping of next generation sequencing data

... due to sequencing errors For NGS sequencers like Illumina and SOLiD, the majority of sequencing errors are of this type The first contribution of this thesis is the introduction of a fast and memory-efficient ... overview of the importance and applications of genomic sequencing We will now present a review of the technologies behind genome sequencing 2.4.1 Sanger S...

Ngày tải lên: 10/09/2015, 09:11

185 324 0
Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

... CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN ... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb...

Ngày tải lên: 03/10/2015, 21:58

116 492 0
Environmental and Social Impacts of Shrimp farming in Tam Giang lagoon, Vietnam-Local perception

Environmental and Social Impacts of Shrimp farming in Tam Giang lagoon, Vietnam-Local perception

... aquaculture in three coastal shrimp farming communes: Phu An, Phu Da and Vinh Ha in Phu Vang district The links between the impacts of shrimp farming and policies, institutions and farming practices ... Numbers of shrimp households and jobs related to shrimp farming in Phu Vang district, Tam Giang lagoon 44 Table 25 Numbers of jobs in different shr...

Ngày tải lên: 02/11/2012, 10:15

130 696 2
UN-REDD programme and the progress of implementing REDD in Vietnam

UN-REDD programme and the progress of implementing REDD in Vietnam

... such as further capacity development and policy and institutional strengthening ⌂ About UN -REDD Vietnam Programme: The question is just focus on the progress of implementing REDD in Vietnam, but ... Meeting, UN -REDD PROGRAMME, 4-5 November 2010, Washington D.C., USA Assessing the Effectiveness of Training and Awareness Raising Activities of the UNREDD...

Ngày tải lên: 23/01/2013, 22:06

6 581 0
English morpheme system and some applications of learning morpheme in establishing words

English morpheme system and some applications of learning morpheme in establishing words

... have introduced some features of English morpheme system as well as its importance in learning English in general and spelling, developing vocabulary in particular It’s also play an 17 English morpheme ... much in learning English Exercise I Count the number of morphemes in each word Underline the bound morphemes alligator calmly running blindness stapler b...

Ngày tải lên: 08/04/2013, 09:31

22 2,3K 6
w