... There was an accident on the highway, and no one could get by get by (on) p.v When you get by or get by on a certain amount of money, you continue with your work or continue with your life even ... would be fun try on try on & tries on trying on tried on tried on try on p.v When you try on an item of clothing before deciding whether you will buy it or borrow it from so...
... succeeded owing to her hard work (verb + owing to) Grammar 13 and the first part of this unit cover linking words that join clauses within a sentence There are also linking words that join ideas across ... order the points we are making First (of all) , Secondly , Next , Then , Finally/lastly/last of all In narrative, the sequence of events can be introduced by: First , Then , After tha...
... trở lòng bàn tay 12 to lay off: sa thải - The company laid off 20 workers yesterday Now they have no job Công ty sa thải 20 công nhân ngày hôm qua Hiện họ việc làm 13.And pigs might fly: lâu được, ... told me that you are going to break up with Rachel Có người nói riêng cho biết anh Rachel chia tay 20 A pain in the neck: nợ, người làm phiền, "kỳ đà cản mũi" - Everytime I play chess wi...
... depend on (someone) for (something) discuss (something) with (someone) distinguish (something) from (something else) dream about/of (someone/something) ... ([doing] something) get rid of (something) graduate from (a place) happen to (someone) help (someone) with (something) hide (something) from (someone) insist (up)on (something) introduce (someone) to ... prohibit (someone) from ([doing...
... 2) difference sets to construct images (96, 20, 4) difference sets in groups of order 32 and then used those images to construct (96, 20, 4) difference sets in GAP[96,221] and GAP[96,231] The difference ... possible (96, 20, 4) difference sets in some 72 groups groups of order 96, those groups that have both factor groups of order 32 and 24 Table l...
... ataatatatatatatatatataataataataataataataataatatgatatatatgtatgtgtaaaataaagaa aagagaatgtataagcgtatggtttctttgcaagaagagcattactgagattggtatg 75 13 150 38 225 63 300 88 AEM05966.1) composed of a single ... cgttcatgcctaccacatgtcgttcacaaccatgcaccttactcctccctgaacaaaaaggatgtggaaaatcag T F M P T T C R S Q P C T L L L P E Q K G C G K S (P-2) S gtgaatgcatctacacatacaaatacggtgaccaatattcattcagcgaagggctttt...
... before than Incorrect: A horse is usefuller than a car Correct: A horse is more useful than a car Adjectives and adverbs having more than one syllable form their comparative and superlative forms