SolidPhase Synthesis of Tetrahydro1,4 benzodiazepine2one Derivatives as a βTurn Peptidomimetic Library

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

... interest students in listening lessons That is the reason why this paper is made a study of using English songs as a kind of supplementary material in teaching listening skill to first year non- major ... OF USING SONGS AS A SUPPLEMENTARY MATERIAL IN TEACHING LISTENING FOR THE FIRST- YEAR NON- MAJOR STUDENTS OF ENGLISH...

Ngày tải lên: 29/01/2014, 10:33

39 1.1K 3
Tài liệu The Value of the Case Study as a Research Strategy doc

Tài liệu The Value of the Case Study as a Research Strategy doc

... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... underlying the case study itself is of a holistic nature Case studies may either focus on a single case or use a number of cases: A single case may...

Ngày tải lên: 20/02/2014, 11:20

15 587 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...

Ngày tải lên: 06/03/2014, 22:21

13 563 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is...

Ngày tải lên: 07/03/2014, 10:20

9 634 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

... types of costing method such as: traditional or absorption costing method, variable costing method, throughput costing method, and ABC costing method Changes in business environments requires a better ... variable costing method was used as the only and easiest way to calculate the costs This is because it is easy to accountants as well as managers and...

Ngày tải lên: 13/03/2014, 14:19

64 512 0
one - pot facile synthesis of iron oxide nanowires as high capacity anode

one - pot facile synthesis of iron oxide nanowires as high capacity anode

... One- pot facile synthesis of iron oxide nanowires as high capacity anode materials for lithium ion batteries Hao Liu*, David Wexler, ... 31 5-3 18 Page of 14 Caption of figures Fig X-ray diffraction pattern of alpha phase iron oxide nanowires Fig SEM and TEM Images of Fe2O3 nanowires and precursors a) The SEM image of ip t Fe2O3 nanowires ... the t...

Ngày tải lên: 20/03/2014, 13:05

15 384 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium th...

Ngày tải lên: 23/03/2014, 15:21

11 501 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

... brevity and apparent validity as a marker for health and health behaviors, self-rated health may prove to be a useful tool for assessing health status among young military members Self-rated health ... health behaviors (e.g., tobacco, alcohol and drunk driving habits) to examine the validity of self-rated overall health as a measure of health...

Ngày tải lên: 20/06/2014, 15:20

9 301 0
Báo cáo hóa học: " Hydrothermal synthesis of MnO2/CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors" potx

Báo cáo hóa học: " Hydrothermal synthesis of MnO2/CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors" potx

... Hydrothermal synthesis of MnO2 /CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors Hui Xia*1, Yu Wang2, Jianyi Lin2, and Li Lu*3 School of Materials ... electrochemical performance of the MnO2 /CNT -5- nanocomposite as an electrode material in supercapacitors was investigated Capacitive behaviors of the p...

Ngày tải lên: 20/06/2014, 23:20

20 470 1
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx

Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx

... Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer Nanoscale Res ... reduction Characterization of Gold Nanotriangles Experimental Details Isolation of Endophytic Aspergillus clavatus The host plant Azadirachta indica...

Ngày tải lên: 21/06/2014, 08:20

7 261 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni .....

Ngày tải lên: 07/08/2014, 18:21

5 205 0
Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc

Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc

... osteosarcoma cells Ant Embryol (Berl) 19 92, 186 :27 1-4 doi: 10.1186/147 7-7 81 9-8 -3 8 Cite this article as: Cheung et al., Bony metastases from breast cancer - a study of foetal antigen as a blood tumour marker ... bony metastases These preliminary data point out that FA -2 is a potential helpful blood marker for bony metastases from breas...

Ngày tải lên: 09/08/2014, 03:21

4 286 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... (Rheumaklinik Aachen, Aachen, Germany), Prof Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany) To assess further the assay specificity, we analyzed ... studies are necessary to screen known autoantigens containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti -SmD3 peptide (SMP) assay (a)...

Ngày tải lên: 09/08/2014, 06:22

11 593 0
w