... Küçükdeveci AA, Sahin H, Ataman S, Griffiths B, Tennant A: Issues in cross-cultural validity: Example from the adaptation, reliability and validity testing of a Turkish version of the Stanford Health Assessment ... a novel approach by assuming that pass scores should be adjusted to ensure the absence of DIF by age and education on each subtest Irrespective of distributional aspects associated with age and ... clear DIF with the older least educated group having a much lower probability of passing, at any given level of cognitive ability, than all other ages and educational levels (age and education are...
Ngày tải lên: 20/06/2014, 15:20
... The time for the test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed ... before That is the reason why it is very difficult for the teacher to design suitable tasks for such a class as the challenging tasks that are suitable for better students are too complicated for ... For example, before the arrival of Mother's Day or Father's Day, the teacher can first play a song about parents, such as STRAW HAT, FATHER AND SON etc, then organize some discussion about parental...
Ngày tải lên: 29/01/2014, 10:33
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr of...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) ... Structure of the thylakoid and envelope membranes of the cyanelles of Cyanophora paradoxa Plant Physiol 71, 409–419 21 Shibata M, Kashino Y, Satoh K & Koike H (2001) Isolation and characterization of...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot
... approximately three weeks after therapy simplification (Figure 1) Neither a preNNRTI GRT assay was available at that time, nor samples of plasma drawn in advance of the NNRTI-based treatment, had ... prevention of mother-to-child HIV transmission Table GRT of proviral and plasma HIV, as interpreted by the Stanford HIV database algorithm (as of March, 2006) HIV-DNA resistance mutations HIV-RNA resistance ... absence of selective pressure, after administration of EFV for a year and a half In such a case, the authors postulated a possible eradication of the wild type quasispecies before HAART failure...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: "In silico evidence for the species-specific conservation of mosquito retroposons: implications as a molecular biomarker" ppt
... quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus Identity strain strain strain strain strain strain strain strain strain strain strain JHB ... effectiveness of DDT immunoconjugates is debatable In our opinion, in view of the devastating impact of diseases such as malaria on individuals and nations within malaria endemic areas, if such nanoparticles ... three RST (AJ970181, AJ970201 and AJ970301) as queries against the 1,778 organismal and the human genome databases by way of BLAST-N calibrated at Expect (E) = 10, Filtration (F) at Default, Description...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt
... development of the BARO, a standardized screening instrument was not available for CPB workers, resulting in a vast qualitative and quantitative variety of reports As a result, it was not clear why ... Cronbach’s alpha Second, the concurrent validity of the instrument was calculated for the participants that underwent the global screening by means of the BARO as well as the elaborate forensic ... with information on the quality of the data for every domain, whether the scoring was based on mono or multi informant data (e.g adolescent, parent, school, guardian, police) has to be indicated...
Ngày tải lên: 13/08/2014, 18:22
Biological properties and the nutrition value of an Isochrysis strain as a live food for geo-duck larvae
... medium for strain was f/2 The Isochrysis galbana strain showed a huge range of fatty acids among, contained remarkable amount of PUFA and considerate level of EPA and DHA which play an essential ... shirai, Katsumi Matumaru, Akio Ohotake, Yoshichika Takamura, Tokujiro Adia and Masayasu Nakano (1989), “Development of a Solid medium for Growth and Isolation of Axenic Microcystis Strains (Cyanobacteria) ... Myristic acid Palmitic Acid Palmitoleic Acid Stearic Acid Oleic Acid Linoleic Acid Anpha-Linoleic Acid Octadecatetraenoic Eicosapentaenoic Acid (EPA) Benhenic acid Docosahexaenoic Acid (DHA) 4.16...
Ngày tải lên: 13/08/2015, 00:34
Design of functional polymeric micelles as a carrier for anticancer drug delivery
... interaction for intracellular uptake after the nanocarriers reach the target site from blood circulation and extravasation There are advantages and drawbacks for each of this strategy that will ... PEG-b-poly(aspartate) as reported by Kataoka’s group [51, 56-58] Conjugation was achieved by the formation of amide bond between the carboxylic groups in poly(aspartate) block and the amine group ... vascular endothelial cell-cell junctions wider to allow for more extravasation of nanoparticles [118] Grafting a targeting ligand onto the surface of nanocarriers on the other hand grants enhanced...
Ngày tải lên: 30/09/2015, 06:07
Application for Employment
... Reason for leaving Attach additional information if necessary I certify that the facts set forth in this application for employment are true and complete ... investigations of my prior educational and employment history I understand that employment at this company is “at will,” which means that either I or this company can terminate the employment relationship ... relationship at any time, with or without prior notice, and for any reason not prohibited by statute All employment is continued on that basis I understand that no supervisor, manager, or executive of...
Ngày tải lên: 21/08/2013, 10:34
POLITELY REJECTING APPLICATION FOR EMPLOYMENT AFTER INTERVIEW
Ngày tải lên: 22/10/2013, 14:15
POLITELY REJECTING APPLICATION FOR EMPLOYMENT, APPLICATION RETAINED ON FILE
Ngày tải lên: 22/10/2013, 14:15
POLITELY REJECTING APPLICATION FOR EMPLOYMENT BEFORE INTERVIEW
Ngày tải lên: 26/10/2013, 21:15
Tài liệu POLITELY REJECTING APPLICATION FOR EMPLOYMENT BEFORE INTERVIEW doc
Ngày tải lên: 24/01/2014, 06:20
Tài liệu HỒ SƠ DỰ TUYỂN - APPLICATION FOR EMPLOYMENT doc
... (EDUCATIONAL BACKGROUND) Tên Trường Name of School / University Chuyên ngành Main Subject Bằng cấp Qualifications Thời gian Time KH A ĐÀO TẠO ĐÃ THAM GIA (ATTENDED TRAINING COURSES) Tên kh a học ... gian Period Tên công ty Company Chức vụ Position Mức lương Salary Lý nghỉ việc Reason for leaving NGƯỜI THAM KHẢO (PROFESSIONAL REFERENCES): Họ & tên Name Thông tin liên lạc Contact information ... Corporation, I commit to fully abide by the Vietnamese labour legistration and will bear responsibility for any violation Chữ ký họ tên người ứng tuyển: Application s signature & name...
Ngày tải lên: 25/01/2014, 18:20
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf
... Comments are welcome and may be addressed to Jennifer Kavanagh, RAND Corporation, 1776 Main Street, Santa Monica, California 90407, or Jennifer_Kavanagh@rand.org For more information on RAND's Forces ... more faults falls drastically as average AFQT score fell Another important observation is that the effect of AFQT is additive, meaning that each additional high-scoring team member increases the ... Their sample includes data from at least two separate deployments between 1981 and 1986 for each class of vessel The authors use several different variables as a proxy for crew experience For example, ...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu The Value of the Case Study as a Research Strategy doc
... case study as a form of data collection and even as a type of unstructured analysis: As a form of research, the case study is unparalleled for its ability to consider a single or complex research ... are especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases Reliability is most important during the data collection phase, and involves ... process of preparation, and has summarized major criticisms An epistemological base for analyzing the value of case study research programmes has been ruled out as a major threat because of inconsistencies...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9...
Ngày tải lên: 06/03/2014, 22:21
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
... to access various sources of information nowadays Manual works in manufacturing has a negative relation with the number of machines that are equipped in factories For example, in the past, a car ... are classified as variable costs today such as: direct labor, direct materials, and manufacturing overhead All of these will be divided equally based on some fixed criteria such as direct labor ... of plants are trying to broaden their capacity each year Generally, small companies not have so many capitals as a result; they can not expand their capacity With such kind of this company, adopting...
Ngày tải lên: 13/03/2014, 14:19