... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain ... 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1.5 T) Historically already in 1994 electron-spin-resonance...
Ngày tải lên: 26/10/2012, 09:07
... the arrowing and labelling results were verified to have the same values as software simulations in Matlab The Spartan-3 FPGA contains a total of 13312 slices The implementation results of the architecture ... about 20% of the chip area on the Spartan-3 FPGA Summary This paper proposed a fast method of implementing the watershed transform based on rainfall simulation...
Ngày tải lên: 21/06/2014, 20:20
Reliability analysis of a power system based on the multi state system theory
... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always co...
Ngày tải lên: 03/01/2014, 19:38
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Aging of the Respiratory System: Impact on Pulmonary Function Tests and Adaptation to Exertion pdf
... and on the tension-time index [33] The tension-time index describes the relationship between force of contraction (Pdi/Pdimax) and duration of contraction (ratio of inspiratory time to total respiratory ... with aging [49] Reduction in supporting tissues around the airways further increases the tendency for the small airways (
Ngày tải lên: 05/03/2014, 21:20
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... Tsugita & Scheffler [23], and amino-acid analysis was carried out on a Hitachi-835 analyzer (Tokyo, Japan) in the standard mode for protein hydrolysate analysis with cation-exchange separation and ... complex band of valent water OH-bond vibrations is overlapped with peaks of valent OH-bond and NH-bond vibrations of PVX CP Thus, to estimate the state of water mole...
Ngày tải lên: 23/03/2014, 13:20
The Design and Implementation of a Java Virtual Machine on a Cluster of Workstations pptx
Ngày tải lên: 23/03/2014, 22:21
báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx
... detect a change in postural control associated with the performance of a secondary cognitive task The ability to stand as still as possible was evaluated under single task (standing still) and dual ... measures like ApEn are useful as indices of relative constraint, because in theoretical terms they are interpreted as a characterization of the dynamic interac...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" The influence of a weight-bearing platform on the mechanical behavior of two Ilizarov ring fixators: tensioned wires vs. half-pins" pdf
... The influence of a weight-bearing platform on the mechanical behavior of two Ilizarov ring fixators: tensioned wires vs halfpins Jan Gessmanna*, Mustafa Citaka, Birger Jettkantb, Thomas A Schildhauera, ... unknown The aim of this study was to analyze the mechanical effects of a weight-bearing platform on the traditional all-wire, four -r...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " On the solvability of a boundary value problem on the real line" pdf
... this article as: Cupini et al.: On the solvability of a boundary value problem on the real line Boundary Value Problems 2011 2011:26 Submit your manuscript to a journal and benefit from: Convenient ... the other required assumptions Similar considerations can be done for the p-Laplacian operator too, using Theorem 2.5 Author details Dipartimento di Matematica -...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article The Effect of a Voice Activity Detector on the Speech Enhancement Performance of the Binaural Multichannel Wiener Filter" ppt
... with attack and release time constants τraise and τdecay The differences between the maxima and minima are calculated to obtain the current dynamic range of the signal (4) The decision for a speech ... vectors containing speech samples will be added to the noise data matrix in (5), which leads to cancellation of parts of the speech signal On the other hand, if t...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf
... paper, regarding NEMO and MANET, are also introduced, such as Multihoming, Route Optimization, and MANEMO 2.1 VANET Vehicular Ad hoc Networks (VANET) are a particular case of MANET, but they are ... in vehicular communications, there is an important lack of real evaluation analysis Many VANET solutions and protocols could be considered as nonpractical designs if they were...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc
... the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag -H bond Due to the charge transfer from the H to the Si adatom on the 1 9H- Si(111 )7 surface, the H atom ... transfer toward the Si adatom when the H sits on the Si adatom There is a strong covalent bond between the H and the Si rest atom when...
Ngày tải lên: 22/06/2014, 00:20
báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx
... multifaceted implementation approach emphasizing collaborative learning and exchange of insights and support among a set of healthcare organizations, like a quality improvement collaborative ... albumin, and BMI per patient per year were performed Data about annually foot and eye examinations, consultations with dieticians and podiatrists, and counseling (advice a...
Ngày tải lên: 10/08/2014, 10:23