An electromechanical impedance based method for tensile force estimation and damage diagnosis of post tensioning systems

Báo cáo khoa học: "An Endogeneous Corpus-Based Method for Structural Noun Phrase Disambiguation" pptx

Báo cáo khoa học: "An Endogeneous Corpus-Based Method for Structural Noun Phrase Disambiguation" pptx

... adj prep noun prep det noun adj noun prep noun noun prep noun prep noun n o u n adj noun noun noun noun prep noun noun prep noun prep noun adj noun prep noun adj adj (3) 110 91 74 53 55 73 47 27 ... no-disambiguation for the ten most frequent ambiguous structures are shown in Table (2) (1) noun noun noun noun noun noun noun 573 331 294 260 241 193 160 82 42...

Ngày tải lên: 09/03/2014, 01:20

6 269 0
Báo cáo y học: "ISsaga is an ensemble of web-based methods for high throughput identification and semiautomatic annotation of insertion sequences in prokaryotic genomes" pdf

Báo cáo y học: "ISsaga is an ensemble of web-based methods for high throughput identification and semiautomatic annotation of insertion sequences in prokaryotic genomes" pdf

... fundamentally to such studies in two ways: firstly by enriching the ISfinder database by high throughput annotation of completely assembled and scaffold-based genomes; and secondly by direct analysis of ... and e-value 1e-5) analysis, which yields an IS prediction and generates a webbased annotation table If no ORFs are found, BLASTN is performed against the ISfind...

Ngày tải lên: 09/08/2014, 22:24

9 672 0
Báo cáo hóa học: " Research Article A New Approximation Method for Solving Variational Inequalities and Fixed Points of Nonexpansive Mappings" docx

Báo cáo hóa học: " Research Article A New Approximation Method for Solving Variational Inequalities and Fixed Points of Nonexpansive Mappings" docx

... approximation methods for nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol 298, no 1, pp 279–291, 2004 G Marino and H K Xu, A general iterative method for nonexpansive ... following variational inequality: f − I q, p − q ≤ ∀p ∈ Ω 3.31 Taking A I, γ and f ≡ u ∈ C is a constant in Theorem 3.1, we get the results of Iiduka and Takahash...

Ngày tải lên: 22/06/2014, 02:20

16 268 0
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

... Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis Jeffrey R Curtis1,#, John W Baddley1,2, Shuo Yang1, ... VARA visits; all other data used for the analysis were from the administrative claims data To test the performance of the effectiveness algorithm...

Ngày tải lên: 25/10/2012, 10:45

29 582 0
A SELF-ASSESSMENT BASED METHOD FOR POST- COMPLETION AUDITS IN PAPER PRODUCTION LINE INVESTMENT PROJECTS doc

A SELF-ASSESSMENT BASED METHOD FOR POST- COMPLETION AUDITS IN PAPER PRODUCTION LINE INVESTMENT PROJECTS doc

... the research gap: Can a practical investment project technology evaluation method for post -completion audits in paper production lines based on a self-assessment framework produce information which ... world forest area) Planted forests and new pulp mills as well as paper mills in Asia and South America have changed pulp and paper supply The world’s demand for...

Ngày tải lên: 18/03/2014, 02:20

193 852 0
07 - immunity-based method for anti-spam model

07 - immunity-based method for anti-spam model

... application for anti-spam based on AIS to implement spam detecting And we developed some series experiments Here are the coefficients for the model as the Table showing TABLE I Parameter COEFFICIENTS FOR ... the model utilized a distributed and multi-hierarchy framework to provide an effective solution for the spam Finally, the experimental results show that the proposed model...

Ngày tải lên: 22/03/2014, 22:26

4 220 0
Báo cáo khoa học: "An Unsupervised Morpheme-Based HMM for Hebrew Morphological Disambiguation" pdf

Báo cáo khoa học: "An Unsupervised Morpheme-Based HMM for Hebrew Morphological Disambiguation" pdf

... 2000 Hebrew morphological analyzer for Hebrew undotted texts Master’s thesis, Technion, Haifa, Israel (in Hebrew) David Carmel and Yoelle S Maarek 1999 Morphological disambiguation for Hebrew ... frequent tag for a given word in the training corpus – for Hebrew and Arabic, shows some intriguing differences: 92.53% for Arabic and 71.85% for Hebrew Furthermore, as ment...

Ngày tải lên: 23/03/2014, 18:20

8 309 0
Báo cáo khoa học: "Feature-based Method for Document Alignment in Comparable News Corpora" ppt

Báo cáo khoa học: "Feature-based Method for Document Alignment in Comparable News Corpora" ppt

... Kasper, and Irina Temnikova 2004 Multilingual and Cross-lingual news topic tracking In Proceedings of the 20th International Conference on Computational Linguistics (COLING) Ralf Steinberger, Bruno ... Bilingual Text Corpora for CrossLanguage Information Integration In Proceedings of the 2005 ACM SIGKDD International Conference on Knowledge Discovery and Data Mining Thuy Vu, Ai Ti Aw...

Ngày tải lên: 24/03/2014, 03:20

9 352 0
Báo cáo khoa học: "Graph Branch Algorithm: An Optimum Tree Search Method for Scored Dependency Graph with Arc Co-occurrence Constraints" potx

Báo cáo khoa học: "Graph Branch Algorithm: An Optimum Tree Search Method for Scored Dependency Graph with Arc Co-occurrence Constraints" potx

... 3: Scored dependency forest 2.5 Semantic Dependency Graph (SDG) The SDG is a semantic-label word DG designed for Japanese sentence analysis The optimum tree search algorithm searches for the optimum ... needed Remove arcj arcj Remove arci arci arcj DGi: Dependency graph for child problem Pi DGj: Dependency graph for child problem Pj Figure 5: Graph branching...

Ngày tải lên: 31/03/2014, 01:20

8 393 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
Báo cáo hóa học: " An extragradient-like approximation method for variational inequalities and fixed point problems" ppt

Báo cáo hóa học: " An extragradient-like approximation method for variational inequalities and fixed point problems" ppt

... theorem by an extragradient method for fixed point problems and variational inequality problems Taiwanese J Math 10(5), 1293–1303 (2006) Moudafi, A: Viscosity approximation methods for fixed- points ... version Later on, Ceng and Yao [11] also introduced an extragradient-like approximation method, which is based on the above extragradient method and viscosity...

Ngày tải lên: 21/06/2014, 01:20

18 279 0
Báo cáo hóa học: " Research Article An Extragradient Method for Mixed Equilibrium Problems and Fixed Point Problems" docx

Báo cáo hóa học: " Research Article An Extragradient Method for Mixed Equilibrium Problems and Fixed Point Problems" docx

... Zeng and Yao 16 introduced a new hybrid iterative algorithm for mixed equilibrium problems and fixed point problems and Mainge and Moudafi 22 introduced an iterative algorithm for equilibrium problems ... theorem for equilibrium problems and fixed point problems of infinite family of nonexpansive mappings,” Fixed Point Theory and Applications, vol 200...

Ngày tải lên: 21/06/2014, 20:20

15 319 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx

Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx

... measurement Automating the fiber diameter measurement and eliminating the use of the human operator is a natural solution to this problem Image Analysis An image analysis based method was proposed ... established a new method based on image analysis in which the problem associated with the intersections was solved The method uses a binary image as an input Then,...

Ngày tải lên: 22/06/2014, 06:20

4 296 0
w