Physicians cancer chemotherapy drug manual2015

Báo cáo hóa học: " Oral Delivery of DMAB-Modified DocetaxelLoaded PLGA-TPGS Nanoparticles for Cancer Chemotherapy" potx

Báo cáo hóa học: " Oral Delivery of DMAB-Modified DocetaxelLoaded PLGA-TPGS Nanoparticles for Cancer Chemotherapy" potx

... of the nanoparticle formulation (3) The advantages in cancer cell viability of the 5% DMABmodified PLGA-TPGS nanoparticles (CNP) >the unmodified PLGA-TPGS nanoparticles (BNP) >the Taxotere® formulation ... [31,32] The cellular uptake of coumarin-6-loaded 5% DMAB-modified PLGA nanoparticles (ANP), unmodified PLGA-TPGS nanoparticles (BNP) and 5% DMAB-modified PLGA-TPG...

Ngày tải lên: 21/06/2014, 08:20

10 250 0
Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx

Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx

... by an established experimental model regarding both viability and functionality of the cells Furthermore, specimens of breast cancer were also treated like the lung tumor samples to verify the ... druginduced expression of caspase-3 was analyzed by flow cytometry In a limited number of experiments, analyses of specific mRNA of caspase-3 were also performed by reverse t...

Ngày tải lên: 12/08/2014, 15:20

11 573 0
ACQUIRED STAT4 DEFICIENCY AS A CONSEQUENCE OF CANCER CHEMOTHERAPY

ACQUIRED STAT4 DEFICIENCY AS A CONSEQUENCE OF CANCER CHEMOTHERAPY

... University, May 2011 Acquired STAT4 deficiency as a consequence of cancer chemotherapy Major Professor: Hua-Chen Chang Signal Transducer and Activator of Transcription (STAT4) is an important transcription ... cause tumor death in a variety of murine models such as melanomas, sarcomas and mammary, colon and renal carcinomas (124) Its antitumor effects are the main c...

Ngày tải lên: 24/08/2014, 10:35

101 229 0
Paclitaxel loaded nanoparticles of biodegradable polymers for cancer chemotherapy

Paclitaxel loaded nanoparticles of biodegradable polymers for cancer chemotherapy

... PACLITAXEL LOADED NANOPARTICLES OF BIODEGRADABLE POLYMERS FOR CANCER CHEMOTHERAPY KHIN YIN WIN (M Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CHEMICAL ... potential analysis of various formulations of paclitaxel- loaded PLGA nanoparticles 81 Figure 13 XRD analyses of paclitaxel, TPGS, blank PLGA nanoparticles and p...

Ngày tải lên: 15/09/2015, 17:08

192 754 0
Stimuli responsive PEGylated nano assemblies for cancer targeted drug delivery

Stimuli responsive PEGylated nano assemblies for cancer targeted drug delivery

... support me at all time My best regards to all, Dai Hai Nguyen Stimuli responsive PEGylated nano- assemblies for cancertargeted drug delivery Supervisor: Professor Ki Dong Park A Dissertation Submitted ... tumours (E) Stimuli- sensitive nanomedicines (F) Local drug delivery Nanocarrier strategies in cancer chemotherapy The use of nanotechnology in medicine and more specif...

Ngày tải lên: 19/05/2016, 10:45

140 143 0
Báo cáo y học: "Current Status of Methods to Assess Cancer Drug Resistance"

Báo cáo y học: "Current Status of Methods to Assess Cancer Drug Resistance"

... strategy of cancer drug therapy seems to be necessary, i.e the management may include, in cases of the detection of broad drug resistance, the omission of aggressive chemotherapy This would help to ... early as the 1950s, research teams started to develop laboratory tests in order to predict tumor reaction to cytostatic drugs [5] They used fresh cancer tissue and exa...

Ngày tải lên: 25/10/2012, 11:10

9 446 0
Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"

Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"

... prospective randomized comparison of and 12 cycles of Cyclophosphamide, Adriamycin and Cisplatin in advanced epithelial ovarian cancer: a Danish ovarian study Group Trial (DACOVA) Gynecol Oncol ... arm completed cycles of first-line chemotherapy only, while an additional cycles of polychemotherapy with FU followed by Cisplatin were proposed for the 61 patients in the Cis...

Ngày tải lên: 03/11/2012, 09:57

10 420 0
Primary Treatment for Locally Advanced Cervical Cancer: Concurrent Platinum-based Chemotherapy and Radiation pptx

Primary Treatment for Locally Advanced Cervical Cancer: Concurrent Platinum-based Chemotherapy and Radiation pptx

... PG 4-5 IN REVIEW Primary Treatment for Locally Advanced Cervical Cancer: Concurrent Platinum-based Chemotherapy and Radiation Practice Guideline Report #4-5 H Lukka, ... Grigsby PW, Cooper J et al Pelvic irradiation with concurrent chemotherapy versus pelvic and para-aortic irradiation for high-risk cervical cancer: An update of Radiation Therapy Oncology...

Ngày tải lên: 06/03/2014, 01:20

31 386 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...

Ngày tải lên: 06/03/2014, 22:21

13 563 0
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

... of PrPC-induced cell drug resistance in gastric cancer cells PI3K/Akt is involved in the activation of P-gp by PrPC in gastric cancer To further investigate the underlying mechanism of PI3K/Akt- mediated ... significantly increased The results indicate that inhibition of the PI3K/Akt signaling pathway may lead to inhibition of the MDR indu...

Ngày tải lên: 07/03/2014, 03:20

10 448 0
Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

... particular phase of the cell cycle, and was associated with an increase in the sub-G1 (apoptotic) portion of the cell cycle We next investigated the effect of combining CDO with the chemotherapeutic ... possible model of drug interaction in GEO cells, which involves the complex interaction of proteins involved in cell cycle regulation To recapitulate, com...

Ngày tải lên: 07/03/2014, 15:20

9 331 0
báo cáo hóa học:" Randomized phase II study with two gemcitabine- and docetaxel-based combinations as first-line chemotherapy for metastatic non-small cell lung cancer" docx

báo cáo hóa học:" Randomized phase II study with two gemcitabine- and docetaxel-based combinations as first-line chemotherapy for metastatic non-small cell lung cancer" docx

... (OS) This randomized phase II trial can be considered as two simultaneous phase II studies: the sample size for each arm was calculated using Simon's one-stage design with a 5% α error and 10% ... carcinoma Other NSCLC Site of disease Lung ± lymph nodes Lung and metastatic site Lung and ≥ metastatic sites Extra-pulmonary disease Previous surgery for neoplas...

Ngày tải lên: 18/06/2014, 15:20

8 538 0
Báo cáo hóa học: " Epidermal growth factor receptor gene copy number in 101 advanced colorectal cancer patients treated with chemotherapy plus cetuximab" doc

Báo cáo hóa học: " Epidermal growth factor receptor gene copy number in 101 advanced colorectal cancer patients treated with chemotherapy plus cetuximab" doc

... difference in PFS was also found in patients treated with Cetuximab plus chemotherapy as second or more line with or without an increased EGFR-GCN (p = 0.03) In our population 89 /101 patients were treated ... EGFR -gene copy number (GCN) in 31 selected patients with metastatic CRC treated with Cetuximab or Panitumumab Eight out of nine patients who obt...

Ngày tải lên: 18/06/2014, 16:20

8 472 0
w