Physicians cancer chemotherapy drug manual2015

Báo cáo hóa học: " Oral Delivery of DMAB-Modified DocetaxelLoaded PLGA-TPGS Nanoparticles for Cancer Chemotherapy" potx

... of the nanoparticle formulation (3) The advantages in cancer cell viability of the 5% DMABmodified PLGA-TPGS nanoparticles (CNP) >the unmodified PLGA-TPGS nanoparticles (BNP) >the Taxotere® formulation ... [31,32] The cellular uptake of coumarin-6-loaded 5% DMAB-modified PLGA nanoparticles (ANP), unmodified PLGA-TPGS nanoparticles (BNP) and 5% DMAB-modified PLGA-TPGS nanoparticles (CNP) was thus ... PLGA-TPGS nanoparticles (BNP) Such advantages of the nanoparticle formulations can be contributed to the effects of TPGS and DMAB component of the nanoparticles in enhancing cellular uptake of...

Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx

... by an established experimental model regarding both viability and functionality of the cells Furthermore, specimens of breast cancer were also treated like the lung tumor samples to verify the ... druginduced expression of caspase-3 was analyzed by flow cytometry In a limited number of experiments, analyses of specific mRNA of caspase-3 were also performed by reverse transcriptase – polymerase ... (8/20 SCC) of all tested specimens, however, there were no related patterns of the drug-induced effects Discussion The major focus of this study was to examine the reliability of a novel ex vivo tissue...

ACQUIRED STAT4 DEFICIENCY AS A CONSEQUENCE OF CANCER CHEMOTHERAPY

... University, May 2011 Acquired STAT4 deficiency as a consequence of cancer chemotherapy Major Professor: Hua-Chen Chang Signal Transducer and Activator of Transcription (STAT4) is an important transcription ... cause tumor death in a variety of murine models such as melanomas, sarcomas and mammary, colon and renal carcinomas (124) Its antitumor effects are the main consequence of activating the primary ... deal of progress 1.6 Roles of STAT4 in Diseases Due to its role as a primary driving force of Th1 differentiation, STAT4 has been implicated in a variety of inflammatory and autoimmune diseases...

Paclitaxel loaded nanoparticles of biodegradable polymers for cancer chemotherapy

... PACLITAXEL LOADED NANOPARTICLES OF BIODEGRADABLE POLYMERS FOR CANCER CHEMOTHERAPY KHIN YIN WIN (M Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CHEMICAL ... potential analysis of various formulations of paclitaxel- loaded PLGA nanoparticles 81 Figure 13 XRD analyses of paclitaxel, TPGS, blank PLGA nanoparticles and paclitaxel- loaded PLGA nanoparticles ... of paclitaxel- loaded PLGA nanoparticles, fluorescent PLGA nanoparticles and standard PS nanoparticles 133 Table Surface chemistry of the formulation materials and the paclitaxel- loaded PLGA nanoparticles...

Stimuli responsive PEGylated nano assemblies for cancer targeted drug delivery

... support me at all time My best regards to all, Dai Hai Nguyen Stimuli responsive PEGylated nano- assemblies for cancertargeted drug delivery Supervisor: Professor Ki Dong Park A Dissertation Submitted ... tumours (E) Stimuli- sensitive nanomedicines (F) Local drug delivery Nanocarrier strategies in cancer chemotherapy The use of nanotechnology in medicine and more specifically drug delivery is ... a delivery vehicle design that was described as the basic anatomy of a drug delivery vehicle Self-assembled nanocarrier for drug delivery Nanoparticles are now available that are attractive for...

Báo cáo y học: "Current Status of Methods to Assess Cancer Drug Resistance"

... strategy of cancer drug therapy seems to be necessary, i.e the management may include, in cases of the detection of broad drug resistance, the omission of aggressive chemotherapy This would help to ... early as the 1950s, research teams started to develop laboratory tests in order to predict tumor reaction to cytostatic drugs [5] They used fresh cancer tissue and examined the effect of the drugs ... as highly predictable, which is not the case with drug sensitivity Results of sensitive drugs obtained by the net effect of drug action on cancer cells are not very reliably, since many steps...

Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"

... prospective randomized comparison of and 12 cycles of Cyclophosphamide, Adriamycin and Cisplatin in advanced epithelial ovarian cancer: a Danish ovarian study Group Trial (DACOVA) Gynecol Oncol ... arm completed cycles of first-line chemotherapy only, while an additional cycles of polychemotherapy with FU followed by Cisplatin were proposed for the 61 patients in the Cisplatin arm Of the ... having completed his B.A in Biochemistry at New York University, is presently in his final year of medical studies at the University of Padua and will pursue resident training in Oncology His current...

Primary Treatment for Locally Advanced Cervical Cancer: Concurrent Platinum-based Chemotherapy and Radiation pptx

... PG 4-5 IN REVIEW Primary Treatment for Locally Advanced Cervical Cancer: Concurrent Platinum-based Chemotherapy and Radiation Practice Guideline Report #4-5 H Lukka, ... Grigsby PW, Cooper J et al Pelvic irradiation with concurrent chemotherapy versus pelvic and para-aortic irradiation for high-risk cervical cancer: An update of Radiation Therapy Oncology Group ... guideline report is a convenient and up-to-date source of the best available evidence on concurrent platinum-based chemotherapy plus radiotherapy as a primary treatment for cervical cancer developed...

Báo cáo khoa học: Identiﬁcation of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG ... ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible...

Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

... of PrPC-induced cell drug resistance in gastric cancer cells PI3K/Akt is involved in the activation of P-gp by PrPC in gastric cancer To further investigate the underlying mechanism of PI3K/Akt- mediated ... signiﬁcantly increased The results indicate that inhibition of the PI3K/Akt signaling pathway may lead to inhibition of the MDR induced by PrPC in gastric cancer cells The mechanism underlying PI3K/Akt- mediated ... PI3K/Akt is involved in PrPC-mediated MDR in gastric cancer In order to study whether activation of the PI3K/Akt signaling pathway played a role in PrPC-induced MDR in gastric cancer cells, the...

Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

... particular phase of the cell cycle, and was associated with an increase in the sub-G1 (apoptotic) portion of the cell cycle We next investigated the effect of combining CDO with the chemotherapeutic ... possible model of drug interaction in GEO cells, which involves the complex interaction of proteins involved in cell cycle regulation To recapitulate, combining CDO with cytotoxic chemotherapy reduced ... culturing with any combination of drug in HCT116 cells, but were signiﬁcantly increased in GEO cells treated with the combination of CDO and 5-FU (Fig 6A) In both HCT116 and GEO cells, there were no...

báo cáo hóa học:" Randomized phase II study with two gemcitabine- and docetaxel-based combinations as first-line chemotherapy for metastatic non-small cell lung cancer" docx

... (OS) This randomized phase II trial can be considered as two simultaneous phase II studies: the sample size for each arm was calculated using Simon's one-stage design with a 5% α error and 10% ... carcinoma Other NSCLC Site of disease Lung ± lymph nodes Lung and metastatic site Lung and ≥ metastatic sites Extra-pulmonary disease Previous surgery for neoplastic disease Yes Palliative Curative ... pharmacokinetic and phase II study of docetaxel in combination with gemcitabine in patients with inoperable non-small cell lung cancer Lung Cancer 2001, 33:277-287 Publish with Bio Med Central and every...

Báo cáo hóa học: " Epidermal growth factor receptor gene copy number in 101 advanced colorectal cancer patients treated with chemotherapy plus cetuximab" doc

... difference in PFS was also found in patients treated with Cetuximab plus chemotherapy as second or more line with or without an increased EGFR-GCN (p = 0.03) In our population 89 /101 patients were treated ... EGFR -gene copy number (GCN) in 31 selected patients with metastatic CRC treated with Cetuximab or Panitumumab Eight out of nine patients who obtained a partial response had an increased EGFR gene ... EGFR-GCN Table 1: FISH Data Patterns FISH Patients % Increased EGFR gene copy number in >50% of cells 56 /101 56 EGFR gene copy number ...

Xem thêm