Optimization of a window frame by BEM and genetic algorithm
Optimization of a window frame by BEM and genetic algorithm
... http://www.emeraldinsight.com/0961-5539.htm Optimization of a window frame by BEM and genetic algorithm Optimization of a window frame 565 Małgorzata Kro´l Department of Heat Supply, Ventilation and Dust Removal Technology, Silesian ... introduction of new materials and additional layers of thermal insulation Because of the new regulations in national and international standards, the admissible value of the heat losses of the walls has ... Kita and Tani (1997) A recent paper of Burczyn´ski et al (2002) discusses the application of BEM and evolutionary algorithms in optimization and identification 567 1.2 Window frame optimization...
- 17
- 344
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... (C), in the presence of 100 lM MPP+ (D), in the presence of 200 lM MPP+ (E), in the presence of 100 lM MPTP and 50 lM dopamine (F), in the presence of 200 lM MPTP and 50 lM dopamine (G), in the presence ... shows the kinetics of aggregation of a-synuclein in the presence of 100 lm MPTP and the effect of 50 lm dopamine on the aggregation process Dopamine delayed the lag phase of aggregation marginally ... solid line), in the presence of 100 lM neurotoxin ( , dotted line), in the presence of 200 lM neurotoxin ( , dotted line) and in the presence of neurotoxin and 50 lM dopamine (h, dashed line) • 1692...
- 11
- 754
- 0
Forest Economic and Environmental Accounting: A pilot study of a first implementation by Statistics Sweden docx
... categories, the State, Other public forests, Company forests and Private Tables 1-2 Table 1a and 2a Data on both area and volume for forest and other wooded land are based on data from the National ... systematic way to fit table Acquisition of land and land area There exist no information divided by industries of land area and acquisition or disposal of land At the best such information can be made ... comments on data availability and quality Physical accounts For the forest balances the original tables have been changed due to both data availability and quality In Sweden the forest balances should...
- 48
- 520
- 0
Find-A-Ride: A listing of TLC Licensed Bases by Borough and by Zip Code pdf
... OCEAN AVENUE 718-676-0126 Paratransit B90605 ALMAZ TRANSPORTATION INC 2313 AVENUE X 718-769-5600 Paratransit B90537 ALTA MEDICAL TRANSPORTATION, INC 2834 CONEY ISLAND AVENUE 212-202-5555 Paratransit ... FIRST CLASS C/L SVC CORP 4980 BROADWAY NEW YORK, NY Last updated Thursday, February 07, 2013 Page of 70 Manhattan Name of Base Street Address Telephone Base Type License # SEAMAN RADIO DISPATCHERS ... GUY'S CAR SVCE 1845 ROCKAWAY PARKWAY DREAMLAND CAR & LIMO.SVC INC 9732 SEAVIEW AVENUE GEORGE TOWN MANAGEMENT INC 919 EAST 107 STREET TRANSIT PVT C/S INC 1417 ROCKAWAY PARKWAY JAH LOVE 582 EAST 88...
- 70
- 615
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... 6C) The simulation results, based on experimentally determined parameters and a kinetic model of the 2393 The glyoxalase pathway in Leishmania infantum pathway, clearly show that the glyoxalase ... http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target relies on its role as the main catabolic pathway...
- 11
- 515
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... of polyneuridine aldehyde into epi-vellosimine This central reaction of the pathway is catalysed by the enzyme polyneuridine aldehyde esterase (PNAE) The QuikChangeTM in vitro Site-Directed Mutagenesis ... Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen,...
- 8
- 345
- 0
step-by-step installation of a secure linux web, dns, and mail server 2004
... Create system aliases: # echo john > /var/qmail/alias/.qmail-root # echo john > /var/qmail/alias/.qmail-postmaster # ln -s /var/qmail/.qmail-postmaster /var/qmail/alias/.qmail-mailer-daemon Key fingerprint ... a and add a space and a non alpha-numeric character W1r HdYdR# Now we have a password that is private, secret, easily remembered and not easily guessable by any program Openna Linux 1.0 Installation ... fingerprint = AF19 FA27 2F94 998D FDB5 DE3D F8B5 06E4 A1 69 4E46 # chmod 644 /var/qmail/alias/.qmail-root /var/qmail/alias/.qmail-postmaster Start qmail and verify it is working: # qmailctl start # qmailctl...
- 74
- 437
- 0
báo cáo hóa học:" Quality of Life as reported by children and parents: a comparison between students and child psychiatric outpatients" ppt
... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined ... J Am Acad Child Adolesc Psychiatry 2008, 47(3):317-327 doi:10.1186/1477-7525-8-136 Cite this article as: Jozefiak et al.: Quality of Life as reported by children and parents: a comparison between ... Norwegian ExtraFoundation for Health and Rehabilitation through EXTRA funds and supported by the Norwegian National Council of Mental Health Thanks to all parents and patients participating in...
- 9
- 494
- 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps
... and (e) 435 after the inoculation To measure the localization -dynamics of expressed proteins and the motility of single cells simultaneously, we used the on-chip microcultivation system and assayed ... when bacterium was stimulated by aspartate Dashed lines show bacterial division points after 80 of stimulation by aspartate, localized Tar was diffused completely Then, the aspartate was removed ... microchamber design, cell preparation, single cell observation, image analysis and drafted the manuscript DS and IK prepared Tar-GFP vector and discussed this study KY conceived of the study, and participated...
- 4
- 166
- 0
Báo cáo y học: " Systems-level comparison of host responses induced by pandemic and seasonal influenza A H1N1 viruses in primary human type I-like alveolar epithelial cells in vitro" pdf
... this article as: Lee et al.: Systems-level comparison of host responses induced by pandemic and seasonal influenza A H1N1 viruses in primary human type I-like alveolar epithelial cells in vitro ... influenza virus in a relevant human respiratory cell model, the primary human type I-like epithelial cells that are a primary target in the lung that may lead to primary viral pneumonia [24,25], including ... level facility at the Department of Microbiology, The University of Hong Kong Isolation of primary human alveolar type II alveolar epithelial cells Primary type II alveolar epithelial cells were...
- 9
- 359
- 0
A markovian approach to the analysis and optimization of a portfolio of credit card accounts
... language The author would also like to thank his parents for their constant support and care Abstract This thesis introduces a novel approach to the analysis and control of a portfolio of credit ... demand, have no alternative but to rationalize and to automate their decision-making processes instead of using the classic judgemental analysis Today, credit card institutions deal with substantial ... the stochastic nature of the cardholders’ repayments first and secondly to the attrition of accounts and to the possible bankruptcy filings Finally an approach unifying the risk sensitivity and the...
- 184
- 497
- 0
Performance optimization of a PEM hydrogen-oxygen fuel cell
... construct a mathematical model for investigating the performance of a PEM fuel cell at different operation variables to optimize its performance by changing some of its parameters Model validation against ... [6] K.S Dhathathreyan, P Sridhar, G Sasikumar, K.K Ghosh, G Velayutham, N Rajalakshmi, C.K Subramaniam, M Raja and K Ramya, Development of polymer electrolyte membrane fuel cell stack Int J Hydrogen ... Proton Exchange Membrane Fuel Cell Stack Fuel cells 2001;1(1):66-71 [12] J Hamelin, K Agbossou, A Laperriere and T.K Bose, Dynamic behavior of a PEM fuel cell stack for stationary applications Int...
- 10
- 489
- 1
Finite time exergoeconomic performance optimization of a thermoacoustic heat engine
... Ceperly P H Gain and efficiency of a traveling wave heat engine J Acoust.Soc Am., 1982, 7(3): 1239-1243 [3] Yazaki T, Iwata A, mackawa T and Tominaga A Traveling wave thermoacoustic engine in a looped ... / F1 and FT = F1 + F2 Here, the total heat transfer surface area FT of the two heat exchangers is assumed to be a constant (3) There is a constant rate of heat leakage ( q ) from the heat source ... i is a complex heat transfer exponent, k1 is the overall heat transfer coefficient and F1 is the total heat transfer surface area of the hot-side heat exchanger, k2 is the overall heat transfer...
- 14
- 411
- 0
Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt
... were used to amplify sequences from 16S rRNA, and primers COIH 2198 (5Ј TAAACTTCAGGGTGACCAAAAAATCA 3Ј) and COIL 1490 (5Ј GGTCAACAAATCATAAAGATATTGG 3Ј; Folmer et al 1994) were used to obtain sequences ... (Sesarma; Schubart et al 1998) Similarly, separation appears to have occurred approximately 19 million years ago between E affinis and E americana (node A) and approximately 23 million years ago between ... BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; (29) Lake Ohnuma, Japan; (30) Lake Akanko, Japan; (31) Caspian Sea; (32) Gulf of Bothnia; (33) Gulf of Finland; (34) Sallvik...
- 14
- 491
- 0
Từ khóa: • building a european facility to simulate the working of the human brain by developing and using supercomputers and neuromorphantimicrobial and anti adhesive potential of a biosurfactants produced by candida speciesof madness and divinations which are made when men are awake and of the power of a melancholy humor by which spirits are sometimes induced into mens bodiesaudiovisual integration in nonhuman primates a window into the anatomy and physiology of cognitionthe gas chromatographic determination of a gasoline component by method of standard additions and an internal standarda viewpoint of microscopic quantum scatterings by electric and magnetic dipolesthen call the students to the front of the class one by one and get each one to pick a scrap with a word topic on it the first one has to stand up and speak freely on that topic for three minutesdrawing a window framethe story of a bad boy by thomas bailey aldrichdescribe the purpose of a business in setting aims and objectivesdescribe the development of a seed from the ovule and embryo sacthink of a number trick between 1 and 100think of a number trick between 1 and 10list of human diseases caused by bacteria and virusesthe art and science of low carbohydrate living by phinney and volekMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ