Vapor phase polymerized thin films and seeding polymerized nanofibers membranes of poly (3,4 ethylenedioxythiophene) for optoelectronic applications
Vapor phase polymerized thin films and seeding polymerized nanofibers membranes of poly (3,4 ethylenedioxythiophene) for optoelectronic applications
... THESIS FOR THE DEGREE OF MASTER OF SCIENCE Advisor: Jae-Do Nam, Professor Vapor- phase Polymerized Thin Films and Seeding -polymerized Nanofibers Membranes of Poly( 3,4 -ethylenedioxythiophene) for Optoelectronic ... (Master of Science) Thesis: Vapor- phase Polymerized Thin Films and Seeding -polymerized Nanofibers Membranes of Poly( 3,4 -...
Ngày tải lên: 22/05/2016, 16:57
Báo cáo "Preparation and characteristics of the In-doped ZnO thin films and the n-ZnO:In/p-Si heterojunctions for optoelectronic switch" potx
Ngày tải lên: 14/03/2014, 13:20
functional thin films and nanostructures for sensors. synthesis, physics, and applications
... Zribi • Jeffrey Fortin Editors Functional Thin Films and Nanostructures for Sensors Synthesis, Physics, and Applications Editors Anis Zribi United Technologies Corporation Fire and Security Kidde ... design considerations related to the use of functional thin films and nanostructures, and specific case studies of functional thin films and nanostructure...
Ngày tải lên: 04/06/2014, 15:14
Báo cáo hóa học: " Facile Synthesis of Novel Nanostructured MnO2 Thin Films and Their Application in Supercapacitors" pptx
... surface of MnO2 and also possible intercalation/deintercalation of H? and alkaline metal cations in the bulk of MnO2 [29] Since the 3-D dandelion-like microspheres of the sample A are composed of ... 1036 substrate in the thin film form The effects of the synthesis temperature on the morphology of the films are investigated, and the capacitive behaviors of nan...
Ngày tải lên: 21/06/2014, 20:20
Growth and characterization of nickel oxide thin films and nanostructures for novel device applications
... dissertation, the growth and characterization of nickel oxide (NiO) for various novel device applications are investigated In the aspect of growth, many methods of both solution-based and physical ... nanowires was demonstrated for the first time The applications of NiO thin films and nanostructures were then investigated for resistive switching memo...
Ngày tải lên: 09/09/2015, 10:07
Solid state dewetting of magnetic binary alloy thin films and application as nanowire and nanotube growth catalysts
... the dewetting process of metal thin film, both liquid -state dewetting and solid- state dewetting However, most of the studies are on dewetting of elemental materials In particular, for solidstate ... Sketch of a liquid drop at solid substrate There are generally two types of dewetting process of thin film, liquidstate and solid- state In liquid -state...
Ngày tải lên: 09/09/2015, 11:26
High tc superconductor, ferroelectric thin films and microwave devices
... YBa2Cu3O7-δ (YBCO) thin films, ferroelectric Ba0.1Sr0.9TiO3 thin films and their applications in passive microwave devices YBCO, Ba0.1Sr0.9TiO3 and multilayer YBCO/Ba0.1Sr0.9TiO3 thin films were fabricated ... 117 References 119 CHAPTER 6: FERROELECTRIC THIN FILMS AND MULTILAYERS 98 121 6.1 Barium strontium titanate ferroelectric thin films 121 6.2 Ba0.1Sr0....
Ngày tải lên: 16/09/2015, 08:30
Magnetic properties of co ta thin films and their applications in magnetic tunnel junctions
... Ta ratio, (ii) Co- Ta of 15% Ta ratio, (iii) Co- Ta of 20% Ta ratio and (iv) Co- Ta of 25% Ta ratio 68 Fig 4.6.4 MFM images of (i) Co, (ii) Co- Ta (5%), (iii) Co- Ta (10%), (iv) Co- Ta (15%), (v) Co- Ta ... Co- Ta (20%) and (vi) Co- Ta (25%) 69 Fig 4.6.5 TEM images showing the crystal structures of (i) Co- Ta of 10% Ta ratio, (ii) Co-...
Ngày tải lên: 10/11/2015, 11:35
Nanomechanical characterization of BD (low k) thin films and cu BD multilayered stacks
... discussed and summarized, as the primary objective of this thesis is the nanomechanical characterization of BD films and Cu /BD stacks Nanomechanical characterization of BD (low- k) thin films and Cu /BD ... In the present Nanomechanical characterization of BD (low- k) thin films and Cu /BD multilayered stacks Chapter Introd...
Ngày tải lên: 26/11/2015, 22:40
Phase II: Estimating Health and Economic Damages (ILLNESS COSTS OF AIR POLLUTION) pdf
... aspects of ICAP and the forecasting of health and economic damages due to air pollution The impacts of two pollutants (i.e., ozone and particulate matter) on human health are analyzed Human health ... together the best knowledge and data on air quality, human health and economics and which would produce forecasts of expected damages (and avoided damages...
Ngày tải lên: 15/03/2014, 16:20
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...
Ngày tải lên: 12/02/2014, 10:20
Báo cáo hóa học: " Research Article An Effective Numerical Method and Its Utilization to Solution of Fractional Models Used in Bioengineering Applications" docx
... paper, we presented an effective numerical method and its application to solution of linear and nonlinear models of fractional order used in bioengineering applications For some of them, Matlab functions ... memory” principle can be used or without using “short memory” principle, we put v for all k in 2.22 Fractional- Order Models in Bioengineering Ap...
Ngày tải lên: 21/06/2014, 05:20