Transcriptome analysis and expression of immune related genes in megalobrama amblycephala after challenge with aeromonas hydrophila

... and expression of immune- related genes of BSB after challenge with A hydrophila is necessary In this thesis, the transcriptome profile and expression of immune- related genes of BSB after challenge ... analyze the expression of immune- related genes (MaTLR5, MaNFKBIA, MaMyD88, MaTRAF6, Transcriptome analysis and expression of immu...

Ngày tải lên: 21/05/2016, 23:07

... revealed the presence of these AP2 domains in the deduced amino acid sequences The structure of the AP2-like genes of the Hordeum genotypes is similar to that of other AP2-like genes (Figure 1) They ... H chilense and H vulgare, wild and domesticated barley respectively, and compared these with other homoeologous genes, including the Q gene from wheat The pa...

Ngày tải lên: 12/08/2014, 03:20

... prepared from the knee joints of normal rats or from rats days (acute phase) or 20 to 28 days (chronic phase of inflammation) after induction of AIA The patella and the menisci of the joints ... normal knee joints or from acutely or chronically inflamed knee joints from AIA rats FLS cells are key players in the propagation of joint inflamm...

Ngày tải lên: 09/08/2014, 10:20

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...

Ngày tải lên: 23/03/2014, 13:20

... of the expression of the enzymes involved in the salvage pathway of GDP-L-fucose indicates that not only the de novo pathway alone, but also the salvage pathway could have an essential role in ... and the corresponding gene has been cloned from human [23] In the present study we have cloned the murine genes coding for the enzymes involved...

Ngày tải lên: 30/03/2014, 13:20

... improvements in symptoms and patient assessments of bladder condition, symptom bother and health-related quality of life in patients with overactive bladder treated with tolterodine Int J Clin ... Changes in UUI episodes were correlated with changes in PPBC and HRQL scores in subjects with OAB treated with either tolterodine ER or placebo...

Ngày tải lên: 18/06/2014, 19:20

... probably regulated by inhibitory actions of Egr-1 in competition for Sp1 binding sites Collectively, these data suggest that, in chondrocytes, alterations in Egr-1 DNA binding activity by TNF-induced ... Research & Therapy Vol 11 No Rockel et al Figure Egr-1 in chondrocytes nallingDNA binding activity increased by TNF-induced MEK1/2 sigEgr-1 DNA binding activity...

Ngày tải lên: 09/08/2014, 01:22

... upregulated in our study, possibly indicating a typical chlamydial activation program of human monocytes The highest ratios and numbers of cytokine genes are induced in the early, active infective ... for cytokine and chemokine receptors as found to be expressed by microarray in Chlamydia trachomatis-infected human monocytes over a time course of up to days Microarray ra...

Ngày tải lên: 09/08/2014, 10:20

... http://www.jmedicalcasereports.com/content/5/1/516 Page of Figure Detection of aberrant DNA methylation in the giant fibroadenoma A: MS-MLPA analysis of DNA isolated from non -giant fibroadenoma None of the analyzed ... methylation and protein expression in breast fibroadenoma and carcinoma Int J Cancer 2005, 114:414-421 Chintamani , Khandelwal R, Tandon M, Yashwant...

Ngày tải lên: 10/08/2014, 23:20

... this article as: Artico et al.: Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data BMC Plant Biology 2010 ... estimated for each experimental set by Miner software [29], and the values were used in all subsequent analysis (Table and Additional file 2) Miner softwa...

Ngày tải lên: 12/08/2014, 03:21

... system according to the intensity and extent of cytoplasmic and nuclear staining According to this grading system, intense HIF-1α staining was observed in 57% (16/28) of AAC, in 100% (20/20) of ... contributed to designing of the study, acquisition of data, and analysis and interpretation of the results KV contributed to designing and acquisition of data, and ana...

Ngày tải lên: 13/08/2014, 08:20

... understanding of the theory of type- 2 fuzzy logic, Chapter provides a brief description of the fundamental theory of type- 2 fuzzy logic including the basics of type- 2 fuzzy set and type- 2 fuzzy logic ... Type- 2 Fuzzy Sets 21 Centroid of a Type- 2 Fuzzy Set 23 2. 2.1 Centroid of a Type- 2 Fuzzy Set 23 2. 2 .2 Centroid...

Ngày tải lên: 09/09/2015, 18:49

... http://jmedicalcasereports.com/jmedicalcasereports/article/view/7289 tomography; MRI, magnetic resonance imaging; ANCA, antineutrophil cytoplasmic antibodies; ANA, antinuclear antibody; dsDNA, double-stranded DNA; SLE, systemic < /b> lupus < /b> erythematosus;< /b> ... Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in < /b> Cases Datab...

Ngày tải lên: 11/08/2014, 17:21

... searched in 2002 for insertions in NBS-LRR-encoding and related genes using BLAST Ten enhancer trap lines and three gene trap lines were identified with insertions into NBS-LRR-encoding or related genes ... the multiple introns in TNL-encoding genes and a paucity of introns in CNL-encoding genes Alternative splicing was confirmed by RACE-PCR and subsequent sequen...

Ngày tải lên: 12/08/2014, 05:20