DEAD box protein csha from staphylococcus aureus and RNA dependent RNA polymerases from viruses

DEAD box protein csha from staphylococcus aureus and RNA dependent RNA polymerases from viruses

DEAD box protein csha from staphylococcus aureus and RNA dependent RNA polymerases from viruses

... Binding Proteins: DEAD- box Protein CshA from Staphylococcus aureus and RNA- dependent RNA Polymerases from Viruses A Dissertation submitted to the Department of Bioscience and Biotechnology and the ... assay of RNA polymerase 90 vii Abstract Enzymatic Studies on Nucleic Acid Binding Proteins: DEAD- box Protein CshA from Staphylococcus aureus and...

Ngày tải lên: 20/05/2016, 15:28

126 238 0
Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx

Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx

... obtained by subtracting the control titration data in the absence of the enzymes from the titration data in the presence of the enzymes The results of the equilibrium binding studies showed that, ... by kinetics in the early part of the reaction course and by thermodynamics in the late part of the reaction course, and therefore the epimerization...

Ngày tải lên: 19/02/2014, 00:20

13 479 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

... GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC ... GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC CCCAAGCTTGAACGCCT...

Ngày tải lên: 06/03/2014, 00:20

13 515 0
Báo cáo y học: "Comparative modeling of DNA and RNA polymerases from Moniliophthora perniciosa mitochondrial plasmid" doc

Báo cáo y học: "Comparative modeling of DNA and RNA polymerases from Moniliophthora perniciosa mitochondrial plasmid" doc

... of the RNA polymerase from M.Palm (green) and Active site of the RNA polymerase from M perniciosa mitochondrial plasmid formed by two domains: Palm (green) and Fingers (red) homology identity, ... fields and include explicitly treated water to reproduce solvent effects [13] After the release of the primary sequences of DNA and RNA polymerases from M pernic...

Ngày tải lên: 13/08/2014, 16:20

6 304 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo khoa học: "Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in central Java in Indonesia and Hesse in Germany" potx

Báo cáo khoa học: "Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in central Java in Indonesia and Hesse in Germany" potx

... among the strains isolated from Central Java, Indonesia and rare among strains isolated from Hesse, Germany Jonsson et al [17] described that the two S aureus fibronectin-binding proteins and ... Adhesion properties of mutants of Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical...

Ngày tải lên: 07/08/2014, 17:22

7 382 0
Báo cáo khoa học: " Resistance to penicillin of Staphylococcus aureus isolates from cows with high somatic cell counts in organic and conventional dairy herds in Denmark" potx

Báo cáo khoa học: " Resistance to penicillin of Staphylococcus aureus isolates from cows with high somatic cell counts in organic and conventional dairy herds in Denmark" potx

... Converting herds one year after conversion Converting herds two years after conversion No of cows tested % of cows with SA No herds with SAr % of herds with SAr % of cows with SA % of cows with SA with ... probably due to the large number of herds without any isolates and the inter/dependence between isolates within the herds resulting in...

Ngày tải lên: 12/08/2014, 18:21

6 332 0
Báo cáo y học: "Ethics roundtable debate: A patient dies from an ICU-acquired infection related to methicillin-resistant Staphylococcus aureus – how do you defend your case and your team" pdf

Báo cáo y học: "Ethics roundtable debate: A patient dies from an ICU-acquired infection related to methicillin-resistant Staphylococcus aureus – how do you defend your case and your team" pdf

... you to defend your case and your team? An American opinion Michael Neiderman In defending the ICU team and in explaining the situation to the family in this scenario, several considerations are ... clinical practice, angiographic and symptomatic cerebral vasospasm is recognized as the main cause of substantial disability and death in patients with subarachnoid haemorrh...

Ngày tải lên: 12/08/2014, 20:21

5 470 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I...

Ngày tải lên: 06/03/2014, 22:21

15 475 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig 2A) was synthesized ... to that of lambdoid phages, indicating that this half of the /11 repressor most likely participates in the binding of operator DNA An N-termin...

Ngày tải lên: 07/03/2014, 00:20

11 432 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

... 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI recognition ... the coupling of M2 with GOA-1 We prepared an M2 mutant: :GOA-1 fusion protein and directly assessed the muscarinic- ligand-dependent activation of GOA-1 Results Expressio...

Ngày tải lên: 07/03/2014, 11:20

9 400 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered on the top ... indicating that Rv1399c is composed of 22% of a- helices, 25% of b-strand and 39% of random coil The catalytic triad is located at the bottom of a s...

Ngày tải lên: 07/03/2014, 16:20

9 584 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên: 16/03/2014, 00:20

9 491 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

... either: (a) dsRNA; or (b) small interference (si )RNA The longer dsRNA may generate a large population of siRNA (with 21–23 nucleotides), and the use of longer dsRNA may be advantageous over siRNA ... corresponding to the mature peptide of MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-...

Ngày tải lên: 16/03/2014, 05:20

11 546 0
w