0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Study of the spiramycin biosynthesis and its regulation in streptomyces ambofaciens

Study of the spiramycin biosynthesis and its regulation in streptomyces ambofaciens

Study of the spiramycin biosynthesis and its regulation in streptomyces ambofaciens

... IN SPIRAMYCIN BIOSYNTHESIS IN STREPTOMYCES AMBOFACIENS 103 Chapter IV: REGULATION OF SPIRAMYCIN BIOSYNTHESIS IN STREPTOMYCES AMBOFACIENS 122 22 22 Chapter V: TRANSCRIPTIONAL ORGANIZATION OF THE ... Modification of the glycosylation pattern through combinatorial biosynthesis 3.6 The regulation of macrolide biosynthesis 3.6.1 Regulation of erythromycin biosynthesis 3.6.2 Regulation of methymycin/pikromycin ... deduced from the protein sequence of the N-terminal region of TylF, the enzyme catalyzing the final step in the biosynthesis of tylosin, were used as probes (Fishman et al., 1987) The cluster of genes...
  • 247
  • 593
  • 0
báo cáo khoa học:

báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc

... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern of the BCL11B gene and four of its related genes (TNFSF10, ... electrophoresis analysis The size of the PCR products of the b2M gene used for the BCL11B reference is 332 bp (line 1, 2) and that used for the four genes of interest is 145 bp (line 4-11) Line 3: DNA ladder...
  • 7
  • 410
  • 0
A study of semantic and pragmatic features of the adjective warm and its vietnamese equivalents

A study of semantic and pragmatic features of the adjective warm and its vietnamese equivalents

... Making an investigation of some semantic and pragmatic features of the adjective Warm in English and its equivalents in Vietnamese - Analyzing meanings of the adjective Warm in particular contexts, ... discover, analyze and contrast Some linguists have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Warm and its adjectives of temperature However, the adjective ... language is Vietnamese The data are classified into semantic and pragmatic features The researcher investigates the data taken from CA Warm- blooded literary works and their Vietnamese equivalents, ...
  • 13
  • 865
  • 0
Báo cáo nghiên cứu khoa học:

Báo cáo nghiên cứu khoa học: "STUDY ON THE ANTIBACTERIAN CHARACTERISTICS OF TEA TREE OIL AND ITS APPLICATION IN COSMETICS" ppt

... composition points out that beside terpinen-4-ol, other components in the tea tree oil have also the added effect of antibacterium 3.3.Investigation of tea tree oil application in cosmetics Since tea ... also other components in the tea tree oil have the antibacterial effect - The accepted dose of all fractions of the tea tree oil in practical use is 0.25% - By adding 1% of the emulsifying reagent ... effect of essential oil evaporation by contacting the agar medium with the essential oil vapor is shown in Table It has pointed out that only the diffusion of the oil determines the antibacterial characteristics...
  • 9
  • 447
  • 0
Báo cáo y học:

Báo cáo y học: "Modeling antibiotic and cytotoxic effects of the dimeric isoquinoline IQ-143 on metabolism and its regulation in Staphylococcus aureu" pot

... Modeling antibiotic and cytotoxic effects of the dimeric isoquinoline IQ-143 on metabolism and its regulation in Staphylococcus aureus, Staphylococcus epidermidis and human cells Genome Biology ... presence of IQ-143 (concentrations of a quarter of the minimum inhibitory concentration and twice the minimum inhibitory concentration) as described in the Materials and methods section and hybridized ... determination of the inhibitory potency of herbal extracts on the activity of six major cytochrome P450 enzymes using liquid chromatography/mass spectrometry and automated online extraction Rapid...
  • 18
  • 338
  • 0
A study of the syntactic, semantic, and pragmatic features of discourse marker only and its Vietnamese translational equivalents

A study of the syntactic, semantic, and pragmatic features of discourse marker only and its Vietnamese translational equivalents

... Vietnamese translational equivalents in terms of syntactic, semantic, and pragmatic features The qualitative results of the analysis are the generalization of syntactic, semantic, and pragmatic features ... English and its For these reasons, the paper entitled "A Study of the Syntactic, Semantic, and Pragmatic Features of discourse marker ONLY and its Vietnamese Translational Equivalents" is aimed to study ... three features: syntax, and Teaching semantics, and pragmatics as this paper As in "A Study on the CHAPTER Semantic and Pragmatic of the Discourse Marker 'Like' and its LITERATURE REVIEWS AND THEORTICAL...
  • 13
  • 431
  • 1
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of the L3 cuticle Results Identification of cDNA ... involved in the molting process, we examined the effects of two PPase specific inhibitors, imidodiphosphate (IDP, 1-0631; Sigma) and NaF on development and molting of A suum lungstage L3 to fourth-stage...
  • 13
  • 691
  • 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

... Luciana Togeiro de Almeida and the Working Group on Development and Environment in the Americas -2- Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian ... and uncoated paper and paperboard 4.87% 6.17% Pulp, cut size, coated and uncoated paper and paperboard 11.47% Pulp, cut size, coated and uncoated paper and chemical papers Number of plants in 2005 ... the three Brazilian companies and comparing with the international Paper performance, the Brazilian group reaches an average lower than foreign subsidiary in five of the six parameters The values...
  • 23
  • 894
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
  • 12
  • 561
  • 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins, the subcellular distribution of glycolytic enzymes ... identified in yeast) PEX17 Several other peroxins are involved in the subsequent steps of the import The import of matrix proteins seems to involve a cascade of interactions between the cargo-loaded...
  • 9
  • 549
  • 0
Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

... CbHs CdHs CeHs CfH NH CaH CbH CdHs CeHs NH CaH CbH CdH NH CaH CbH CdHs CeHs CfH NH CaH CbH CbHÂ CdHs CeHs OH NH CaH CbH3 NH CaH CbH CcH3 NH CaH CbH CbHÂ CcH CdH3 CdH3Â NH CaH CbH3 NH CaH CbH ... NH CaH CbH CbHÂ NdH NH CaH CbH CcH3 NH CaH CbH CcH3 CcH3Â NH CaH CbH CbH CdHs CfH NH CaH CaHÂ NH CbH CbHÂ CdHs CeHs CfH NH CaH CbH CdHs CeHs CfH NH CaH CbHs CcH CeH3 CaH CbH CcHs CcHÂ CdH3 3.25 ... position E7 as the source of the H- bond to ligand on the basis of a partial sequence, which had indicated a Tyr on the distal E-helix The similarity in the 1H NMR spectra of the three globin complexes...
  • 14
  • 504
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam " docx

... not defined Institute Information Project Name Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam Vietnamese Institution ... provincial councils in Mekong Delta 22 shared the existing information and experiences on rice cracking The document prepared (in Vietnamese only) during the workshop will be presented in the next progress ... investigate the effect of tempering on the increase in the mechanical strength of rice This was the preliminary work mainly to establish the methodology and feasibility of the research The glass transition...
  • 16
  • 512
  • 0
Project Progress Report:

Project Progress Report: " Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam - Ms5" pot

... Name Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam Vietnamese Institution Nong Lam University Vietnamese Project ... training courses, based on the outcome of the survey and experiments The above activities can be clustered into groups: - The 8-ton dryer - The 1-ton dryer - Survey, training, and extension The ... more rice cracking during milling This explains why dryers installed since 2003 have been more and more of the reversible principle - Air reversal also decreased the drying time - The drying temperature...
  • 24
  • 538
  • 0
INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM

INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM " ppt

... Province Project: INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM Figure 1: Opening by Dr Truong Vinh, CARD 026/VIE05 ... Declaration the reason of training program – Introduction the delegates, participants 8:10 – 8:15: Introduction the content of the training program (Dr Vinh Truong) 8:15 – 8:20: Statement of local officer ... Meeting hall of people’s committee of Tân Hiệp district 8:00 – 8:10: Declaration the reason of training program – Introduction the delegates, participants 8:10 – 8:15: Introduction the content of...
  • 18
  • 435
  • 0

Xem thêm

Từ khóa: the circuitry of the human spinal cord its role in motor control and movement disordersdisorders of the pituitary gland and its hypothalamic controldiseases of the nervous system and its symptomsexplain the structure of unix operating system and its components in briefunspecified disorder of the pituitary gland and its hypothalamic controldescription of the subsequent event and its nature the factor that casts doubt upon the company s ability to continue operating as a going concerna brief history of the north atlantic and its resourcesthe transformation of the financial system and its impact on business models and bank risktable 2 1 purpose of the expression interface and its implementerstable a 1 purpose of the expression interface and its implementers2non invasive recording of the cardiac parameters and its significancesimilarities and differences of idioms containing the word heart and its synonyms in vietnamese in the light of culturem borg e hultcrantz m webster db 1987 morphological and electrophysiological study of the inner ear and the central auditory pathways following whole body fetal irradiation hear res 26 95 104the circuitry of the human spinal cord its role in motor controlthe o fid and its applications in petroleum product analysisBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP