Study of the spiramycin biosynthesis and its regulation in streptomyces ambofaciens

... IN SPIRAMYCIN BIOSYNTHESIS IN STREPTOMYCES AMBOFACIENS 103 Chapter IV: REGULATION OF SPIRAMYCIN BIOSYNTHESIS IN STREPTOMYCES AMBOFACIENS 122 22 22 Chapter V: TRANSCRIPTIONAL ORGANIZATION OF THE ... Modification of the glycosylation pattern through combinatorial biosynthesis 3.6 The regulation of macrolide biosynthesis 3.6.1 Regulation of erythro...

Ngày tải lên: 19/05/2016, 11:22

... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern...

Ngày tải lên: 10/08/2014, 22:21

... Making an investigation of some semantic and pragmatic features of the adjective Warm in English and its equivalents in Vietnamese - Analyzing meanings of the adjective Warm in particular contexts, ... discover, analyze and contrast Some linguists have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Wa...

Ngày tải lên: 26/11/2013, 13:21

... composition points out that beside terpinen-4-ol, other components in the tea tree oil have also the added effect of antibacterium 3.3.Investigation of tea tree oil application in cosmetics Since tea ... also other components in the tea tree oil have the antibacterial effect - The accepted dose of all fractions of the tea tree oil in pra...

Ngày tải lên: 22/07/2014, 03:20

... Modeling antibiotic and cytotoxic effects of the dimeric isoquinoline IQ-143 on metabolism and its regulation in Staphylococcus aureus, Staphylococcus epidermidis and human cells Genome Biology ... presence of IQ-143 (concentrations of a quarter of the minimum inhibitory concentration and twice the minimum inhibitory concentration) as describe...

Ngày tải lên: 09/08/2014, 22:24

... Vietnamese translational equivalents in terms of syntactic, semantic, and pragmatic features The qualitative results of the analysis are the generalization of syntactic, semantic, and pragmatic features ... English and its For these reasons, the paper entitled "A Study of the Syntactic, Semantic, and Pragmatic Features of discour...

Ngày tải lên: 11/05/2016, 14:57

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of...

Ngày tải lên: 20/02/2014, 11:20

... Luciana Togeiro de Almeida and the Working Group on Development and Environment in the Americas -2- Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian ... and uncoated paper and paperboard 4.87% 6.17% Pulp, cut size, coated and uncoated paper and paperboard 11.47% Pulp, cut size, coated and uncoate...

Ngày tải lên: 22/02/2014, 09:20

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...

Ngày tải lên: 23/03/2014, 17:21

... CbHs CdHs CeHs CfH NH CaH CbH CdHs CeHs NH CaH CbH CdH NH CaH CbH CdHs CeHs CfH NH CaH CbH CbHÂ CdHs CeHs OH NH CaH CbH3 NH CaH CbH CcH3 NH CaH CbH CbHÂ CcH CdH3 CdH3Â NH CaH CbH3 NH CaH CbH ... NH CaH CbH CbHÂ NdH NH CaH CbH CcH3 NH CaH CbH CcH3 CcH3Â NH CaH CbH CbH CdHs CfH NH CaH CaHÂ NH CbH CbHÂ CdHs CeHs CfH NH CaH CbH CdHs CeHs CfH NH CaH CbHs CcH CeH3 CaH CbH CcHs CcHÂ CdH3 3.25 ... po...

Ngày tải lên: 23/03/2014, 17:22

... not defined Institute Information Project Name Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam Vietnamese Institution ... provincial councils in Mekong Delta 22 shared the existing information and experiences on rice cracking The document prepared (in...

Ngày tải lên: 21/06/2014, 06:20

... Name Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam Vietnamese Institution Nong Lam University Vietnamese Project ... training courses, based on the outcome of the survey and experiments The above activities can be clustered into groups: - The 8-ton...

Ngày tải lên: 21/06/2014, 06:20

... Province Project: INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM Figure 1: Opening by Dr Truong Vinh, CARD 026/VIE05 ... Declaration the reason of training program – Introduction the delegates, participants 8:10 – 8:15: Introduction the content of the trai...

Ngày tải lên: 21/06/2014, 06:20