The evolving role of IT managers and CIOs findings from the 2010 IBM global IT risk study
The evolving role of IT managers and CIOs findings from the 2010 IBM global IT risk study
... and mitigate risk throughout their business – particularly as it applies to IT – IBM initiated the 2010 IBM Global IT Risk Study, part of the ongoing research IBM conducts in the area of IT risk, ... Figure 5: IT managers expect their areas of responsibility to shift over the next three years The findings of the 2010 IBM Global IT Risk Study revealed areas of focus that can help IT managers ... associated with IT risk, and the steps IT managers and CIOs are taking to better understand, confront and resolve this concern Of the IT managers surveyed, most expect their risk- related responsibilities...
- 16
- 177
- 0
Báo cáo y học: " Young adult obese subjects with and without insulin resistance: what is the role of chronic inflammation and how to weigh it non-invasively" docx
... correlated with insulin sensitivity [23], contrary to adults This last aspect makes gain ground to the hypothesis that IR presence is associated with inflammation after many years and probably liver ... able to confirm this point Being IR not related to the entity of fat deposition, we hypothesize that the chain of events does not presuppose the obesity as if it was the cause of IR; this fact is ... obesity (BMI and WC, [21]) A second point of the problem to stress is whether the weight control can slow down the progression of IR and the worsening of fat deposition in organs in these obese young...
- 6
- 542
- 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx
... magnitude of the public health impact of AEDs is potentially dramatic, in terms of both life-saving and ICU resources In summary, the use of AEDs by the average person may be considered one of the ... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, the usual ... intervals between interruption of chest compressions and the delivery of the countershock should be limited to only a few seconds [8,20] In all of these areas of concern, evolving technology will...
- 3
- 280
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
- 15
- 635
- 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... good enterprises, they appear unable to ration bad ones Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey ENTERPRISE ADJUSTMENT AND THE ROLE ... Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey In 1996, the credit has overall been decreasing for 53% of the sample, it has been increasing ... passive, and will appear as endogenous variable in section 10 Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey resources as an important...
- 30
- 635
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786 2957 84 6 3.91 ± 1.06 3.76 ± 1.61 2 .82 ± 0.92 ... Faussner et al Role of helix and C-termini in bradykinin receptors Fig Schematic representation of the C-terminal B1wt and B2wt sequences and chimera thereof The C-terminal sequences beginning at transmembrane...
- 12
- 595
- 0
Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc
... CENTER FOR AUDIT QUALITY OBSERVATIONS ON THE EVOLVING ROLE OF THE AUDITOR A SUMMARY OF STAKEHOLDER DISCUSSIONS Introduction Over the years, the role of the public company auditor has been examined ... to the roundtable participants to assure that it fairly describes the observations made during the sessions CENTER FOR AUDIT QUALITY OBSERVATIONS ON THE EVOLVING ROLE OF THE AUDITOR A SUMMARY OF ... information or the levels of assurance that would be appropriate Also, some CENTER FOR AUDIT QUALITY OBSERVATIONS ON THE EVOLVING ROLE OF THE AUDITOR A SUMMARY OF STAKEHOLDER DISCUSSIONS participants thought...
- 20
- 388
- 0
Role of an electrolyte and substrate on the stability of porous silicon
... conforms the viability of textured substrates and ethanol-based electrolyte as a requisite condition for the formation of highly luminescent, thick and stable porous silicon films Porous silicon ... luminescent properties and stability of porous silicon films Conclusions The visual observation of mechanically strong, stable surface bond configuration, smooth surface morphology and hydrogen-passivated ... evaluating the degradation of stability of PS on electrolyte (HF–C2H5OH and HF–H2O2) and current density formed on textured and polished Si substrates, respectively The emphasis is mainly 265 on the...
- 9
- 537
- 0
The Role of Deployments in Competency Development - Experience from Prince Sultan Air Base and Eskan Village in Saudi Arabia potx
... reviewed, they are not expected to be comprehensive and may present preliminary findings The Role of Deployments in Competency Development Experience from Prince Sultan Air Base and Eskan Village in Saudi ... personnel vis-à-vis the learning of officers METHODS We opted to focus on learning experiences specifically at Prince Sultan Air Base (PSAB) /Eskan Village rather than assess the development of officers ... pertaining to the nature and extent of airmen development occurring within the Training, Exercise, and Deployment (TED) arena Specifically, they asked whether officers learn enough during contingency...
- 78
- 885
- 0
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx
... Rhee SG (20 01) Inactivation of human FEBS Journal 27 5 (20 08) 29 42 29 55 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 29 53 Cysteinyl-based modification of the 20 S proteasome 10 11 12 13 14 15 ... investigating whether that common feature is related to their easy entry into the latent 20 S particle Cysteinyl-based modification of the 20 S proteasome According to our data, Grx2 is ubiquitinated ... preparations obtained FEBS Journal 27 5 (20 08) 29 42 29 55 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 29 43 Cysteinyl-based modification of the 20 S proteasome G M Silva et al from cells grown in glycerol...
- 14
- 364
- 0
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf
... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity in the pH optimum Fig Inactivation of ... 97 and 3 31 side chains are conserved in the mutants R97M and Y331F, but the hydrogen bond-forming atoms have been removed In mutant E187D, the distance between the catalytic nucleophile and the...
- 10
- 522
- 0
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx
... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in this work We sought to determine the role of ... [5,14] To understand the importance of capsid protein–protein contacts for the stability of coat protein, we determined the stability of dlFG and compared it with the stability of the genetically...
- 13
- 448
- 0
Từ khóa: looking forward the future and evolving role of ecology in societythe role of it in successful knowledge management initiativesenos uncoupling in cardiovascular diseases the role of oxidative stress and inflammationthe role of teachers schools and communities in quality educationwhat is the main role of mac address and ip address in computer networksthe nature of management managers and their workexplain the role of art music and dance in african societythe role of students attitudes and motivation in second language learning in online language coursesthe role of sound music and sound effect in the film industrythe role of oxidative stress and inflammation in dry eye diseasethe role of effective communication and interpersonal interaction in health and social careanalyze the role of critical thinking and education for lifeevolving role of the cio ibmwhat is the role of effective communication and interpersonal interaction in health and social carethe role of oxidative stress and antioxidant treatment in experimental diabetic neuropathyBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ