The evolving role of IT managers and CIOs findings from the 2010 IBM global IT risk study

The evolving role of IT managers and CIOs findings from the 2010 IBM global IT risk study

The evolving role of IT managers and CIOs findings from the 2010 IBM global IT risk study

... and mitigate risk throughout their business – particularly as it applies to IT – IBM initiated the 2010 IBM Global IT Risk Study, part of the ongoing research IBM conducts in the area of IT risk, ... Figure 5: IT managers expect their areas of responsibility to shift over the next three years The findings of the 2010 IBM Global IT R...

Ngày tải lên: 06/12/2015, 23:16

16 177 0
Báo cáo y học: " Young adult obese subjects with and without insulin resistance: what is the role of chronic inflammation and how to weigh it non-invasively" docx

Báo cáo y học: " Young adult obese subjects with and without insulin resistance: what is the role of chronic inflammation and how to weigh it non-invasively" docx

... correlated with insulin sensitivity [23], contrary to adults This last aspect makes gain ground to the hypothesis that IR presence is associated with inflammation after many years and probably liver ... able to confirm this point Being IR not related to the entity of fat deposition, we hypothesize that the chain of events does not presuppose the obesity as if...

Ngày tải lên: 11/08/2014, 08:22

6 543 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

... magnitude of the public health impact of AEDs is potentially dramatic, in terms of both life-saving and ICU resources In summary, the use of AEDs by the average person may be considered one of the ... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of...

Ngày tải lên: 12/08/2014, 23:21

3 281 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

... good enterprises, they appear unable to ration bad ones Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey ENTERPRISE ADJUSTMENT AND THE ROLE ... Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey In 1996,...

Ngày tải lên: 06/03/2014, 08:20

30 635 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...

Ngày tải lên: 07/03/2014, 16:20

12 595 0
Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc

Center for Audit Quality Observations on the Evolving Role of the Auditor: A Summary of Stakeholder Discussions doc

... CENTER FOR AUDIT QUALITY OBSERVATIONS ON THE EVOLVING ROLE OF THE AUDITOR A SUMMARY OF STAKEHOLDER DISCUSSIONS Introduction Over the years, the role of the public company auditor has been examined ... to the roundtable participants to assure that it fairly describes the observations made during the sessions CENTER FOR AUDIT QUALITY OBS...

Ngày tải lên: 15/03/2014, 20:20

20 388 0
Role of an electrolyte and substrate on the stability of porous silicon

Role of an electrolyte and substrate on the stability of porous silicon

... conforms the viability of textured substrates and ethanol-based electrolyte as a requisite condition for the formation of highly luminescent, thick and stable porous silicon films Porous silicon ... luminescent properties and stability of porous silicon films Conclusions The visual observation of mechanically strong, stable surface bond configuration, smooth s...

Ngày tải lên: 16/03/2014, 15:19

9 537 0
The Role of Deployments in Competency Development - Experience from Prince Sultan Air Base and Eskan Village in Saudi Arabia potx

The Role of Deployments in Competency Development - Experience from Prince Sultan Air Base and Eskan Village in Saudi Arabia potx

... reviewed, they are not expected to be comprehensive and may present preliminary findings The Role of Deployments in Competency Development Experience from Prince Sultan Air Base and Eskan Village in Saudi ... personnel vis-à-vis the learning of officers METHODS We opted to focus on learning experiences specifically at Prince Sultan Air Base (PS...

Ngày tải lên: 23/03/2014, 01:20

78 885 0
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

... Rhee SG (20 01) Inactivation of human FEBS Journal 27 5 (20 08) 29 42 29 55 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 29 53 Cysteinyl-based modification of the 20 S proteasome 10 11 12 13 14 15 ... investigating whether that common feature is related to their easy entry into the latent 20 S particle Cysteinyl-based modification of the 20 S proteasome...

Ngày tải lên: 23/03/2014, 07:20

14 364 0
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity...

Ngày tải lên: 23/03/2014, 15:21

10 522 0
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx

Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx

... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in...

Ngày tải lên: 30/03/2014, 11:20

13 448 0
w