Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... 300070, PR China Abstract To develop pullulan acetate nanoparticles (PANs) as a drug nanocarrier, pullulan acetate (PA) was synthesized and characterized. Its acetylation degree determined by the ... buered formalin, embedded in paraf- n, sectioned, and stained with hematoxylin and eosin (H&E). In vivo pharmacokinetics and bioavailability In vivo pharmac...
Ngày tải lên: 23/04/2013, 21:38
... amplification with primers 5¢- CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢- TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢. ... 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢- GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag under- lined) or 5¢- TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3...
Ngày tải lên: 07/03/2014, 21:20
... progression of neuronal development, as well as for cancer diagnos- tics and therapeutic application in human medicine. Conclusion Recently, the increased interest in miRNAs, and con- cerns that miRNAs are ... regu- latory networks during developmental stages and the changes of these networks in disease and after applica- tion of a variety of therapeutic strategies...
Ngày tải lên: 16/03/2014, 01:20
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
Ngày tải lên: 05/09/2013, 09:38
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx
... family of adaptor proteins, which lack intrinsic enzymatic activity and share a common multidomain structure. These adaptors bind to several receptor tyrosine kinases and signaling proteins, and ... EEA1 (endosomal marker), Na + ⁄ K + -ATPase (plasma membrane marker) and caln- exin (ER marker) as indicated. Top: representative immunoblots in control ()ins) and insulin-inject...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Aesthetic preferences and the attribution of meaning: Environmental categorization processes in the evaluation of urban scenes ppt
... evaluaran tanto sus propiedades restauradoras—en te´rminos de la ART—como el grado en que exhibı a determinadas caracterı´sticas ambientales. Los participantes expresaron una clara preferencia este´tica ... the restorative capacity of a specific place in terms of the ART—(Hartig, Korpela, Evans, & Ga¨rling, 1997) as well as analysing the role that this capacity may play in t...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... during exponential growth; it starts to accumulate at the early stationary phase, and its steady-state level increases further during the late stationary phase. As a result of this accumulation, ... conditions at the stationary phase and as a result of starvation. E. coli MC4100 was grown at 37 °C in Luria–Bertani or minimal media and the samples were withdrawn at 30-min...
Ngày tải lên: 22/02/2014, 07:20
PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx
... Examination The mental status evaluation involves observing patients and asking questions to gather information about a patient’s behavior and appearance, ambulation and move- ment, mood and ... increasingly PET in the Evaluation of Alzheimer’s Disease and Related Disorders 14 L.M. Ercoli and G.W. Small disparate items are alike (e.g., ask how a table and a cha...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b. ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A. thali- ana are already available [26]. We were able to obtain one T-DNA insertion line each for...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... Medicina y Farmacia., Universidad de Valencia, Valencia, Spain Several clinical trials have revealed that individuals who were given b)carotene and vitamin A did not have a reduced risk of cancer ... supple- mented rats by the technique of differential display. As expression of c-H-Ras was found to be lower and that of p53 7 was higher in chronic vitamin A deficiency and...
Ngày tải lên: 08/03/2014, 08:20