Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... 300070, PR China Abstract To develop pullulan acetate nanoparticles (PANs) as a drug nanocarrier, pullulan acetate (PA) was synthesized and characterized. Its acetylation degree determined by the ... buered formalin, embedded in paraf- n, sectioned, and stained with hematoxylin and eosin (H&E). In vivo pharmacokinetics and bioavailability In vivo pharmac...
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-
CACCAC
CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢
(His-tag underlined) or 5¢-
TGGAGCCACCCGCAGTTCG
AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag
underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC
TTGGGTCG-3¢. ... 5¢-GCGGAGCTCATGGCCAC
AAGCGCATCAGC-3¢ and 5¢-
GTGGTGGTGGTGGTGG
TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag under-
lined) or 5¢-
TGGAGCCACCCGCAGTTCGAAAAAGAA
GCTGGAGATGATCGTGCT-3...
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... progression
of neuronal development, as well as for cancer diagnos-
tics and therapeutic application in human medicine.
Conclusion
Recently, the increased interest in miRNAs, and con-
cerns that miRNAs are ... regu-
latory networks during developmental stages and the
changes of these networks in disease and after applica-
tion of a variety of therapeutic strategies...
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx
... family
of adaptor proteins, which lack intrinsic enzymatic
activity and share a common multidomain structure.
These adaptors bind to several receptor tyrosine kinases
and signaling proteins, and ... EEA1 (endosomal marker), Na
+
⁄ K
+
-ATPase (plasma membrane marker) and caln-
exin (ER marker) as indicated. Top: representative immunoblots in control ()ins) and insulin-inject...
Tài liệu Aesthetic preferences and the attribution of meaning: Environmental categorization processes in the evaluation of urban scenes ppt
... evaluaran tanto sus propiedades restauradoras—en te´rminos de la ART—como el grado
en que exhibı a determinadas caracterı´sticas ambientales. Los participantes expresaron una clara preferencia
este´tica ... the
restorative capacity of a specific place in terms
of the ART—(Hartig, Korpela, Evans, & Ga¨rling,
1997) as well as analysing the role that this capacity
may play in t...
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... during exponential growth; it
starts to accumulate at the early stationary phase, and its
steady-state level increases further during the late stationary
phase. As a result of this accumulation, ... conditions at the stationary phase and as a result of starvation. E. coli MC4100 was grown
at 37 °C in Luria–Bertani or minimal media and the samples were withdrawn at 30-min...
PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx
... Examination
The mental status evaluation involves observing patients and asking questions to
gather information about a patient’s behavior and appearance, ambulation and move-
ment, mood and ... increasingly
PET in the Evaluation of Alzheimer’s Disease
and Related Disorders
14 L.M. Ercoli and G.W. Small
disparate items are alike (e.g., ask how a table and a cha...
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT
GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG
GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT
ATCAGCAGAAGCAATGTGGTGATA) and 70b R2
(TTACTGAGATGTCTTGTTCTTGGAAATGT) primers
for atrpa70b. ... (AtRPA7 0a and AtRPA70b, respectively)
and because many T-DNA insertion mutants of A. thali-
ana are already available [26]. We were able to obtain
one T-DNA insertion line each for...
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... Medicina y Farmacia., Universidad de Valencia, Valencia, Spain
Several clinical trials have revealed that individuals who were
given b)carotene and vitamin A did not have a reduced risk
of cancer ... supple-
mented rats by the technique of differential display. As
expression of c-H-Ras was found to be lower and that of p53
7
was higher in chronic vitamin A deficiency and...