Overcoming mass transfer barriers in sandwich configuration for primary hepatocytes culture

Overcoming mass transfer barriers in sandwich configuration for primary hepatocytes culture

Overcoming mass transfer barriers in sandwich configuration for primary hepatocytes culture

... engineering 13 1.2.2 Polarity genesis of hepatocytes in sandwich culture 14 1.2.3 Functional maintenance of hepatocytes in sandwich culture .16 1.2.4 Inherent mass transfer barriers in sandwich ... conventional sandwich configuration for primary hepatocytes culture combining principles and technologies from tissue engineering, chemistry and bioreactor eng...

Ngày tải lên: 27/11/2015, 12:39

105 214 0
Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot

Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot

... tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag act gtc ttc acg cag aag cgt cta gcc at cga gac ctc ccg ggg cac tcg caa gca ccc acg cag ... aaa gcg tct agc cat ggc gtt agt tcc cgg ggc act cgc aag cac cct atc agg ggg ccg ggc atg aga cac gct gtg ata aat gtc 1The primers were designed with the program PrimerSelect (DNASTAR) using con...

Ngày tải lên: 19/06/2014, 08:20

17 479 0
A study of the authenticity in chinese textbook for primary students of singapore

A study of the authenticity in chinese textbook for primary students of singapore

... 新加坡《小学华文》真实性研究 A STUDY OF THE AUTHENTICITY IN CHINESE TEXTBOOK FOR PRIMARY STUDENTS OF SINGAPORE 王颖 WANG YING (B .A, TJNU) 新加坡国立大学中文系 硕士学位论文 A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ARTS DEPARTMENT OF ... T) The issue of authenti cit y of t ext and int eractions is fast becomi ng a m ajor focus in language p...

Ngày tải lên: 26/09/2015, 10:13

118 1,2K 0
MÔ HìNH HOá QUá TRìNH TRAO ĐổI NHIệT ẩM TRONG MáY ấP TRứNG GIA CầM Modeling of heat and mass transfer in chicken egg incubators

MÔ HìNH HOá QUá TRìNH TRAO ĐổI NHIệT ẩM TRONG MáY ấP TRứNG GIA CầM Modeling of heat and mass transfer in chicken egg incubators

... 3.4 Mô hình toán học trình trao đổi nhiệt ẩm vùng chứa trứng Từ mô hình động học (6) phơng trình nhiệt độ độ ẩm dòng khí trứng (35), (36) (38) ta xác định đợc hệ phơng trình mô tả trạng thái nhiệt ... lợng trứng: 224 (1 ) drT h fT t = hcTa Av (Ta TT ) + (1 ) drT hP + (1 ) drT hD (TT ) X t (34) 3.3 Đơn giản hoá mô hình nhiệt ẩm vùng chứa trứng Mô...

Ngày tải lên: 28/08/2013, 08:31

9 1,5K 5
Natural convection unsteady magnetohydrodynamic mass transfer flow past an infinite vertical porous plate in presence of suction and heat sink

Natural convection unsteady magnetohydrodynamic mass transfer flow past an infinite vertical porous plate in presence of suction and heat sink

... free convection flow past an infinite vertical plate with constant suction and mass transfer Int J Heat Mass Trans.1977, 20, 1363-1373 [5] Hossain M A., Begum R A Effect of mass transfer and free ... convection mass transfer flow of a viscous incompressible electrically conducting fluid past an infinite vertical porous plate in presen...

Ngày tải lên: 05/09/2013, 15:28

14 493 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

... containing a low-potential and a high-potential [Fe-S] Thus each structural domain of b may be a transfer unit for the electron transfer pathway in this enzyme In our scheme we have integrated these ... described for fumarate reductase from Escherichia coli, where the separation of oxidative and reductive activities suggests there are two quinol binding sites...

Ngày tải lên: 07/03/2014, 15:20

8 443 0
Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

... signal was observed in all peptides containing tyrosine 23 or 53 but not in peptides containing tyrosine 20 alone According to these results, tyrosines 23 and 53 could be involved in the dimerizations ... estimate the TrpÆ and TyrOÆ yields in the lysozymes from the magnitudes of the absorbance changes at 510 and 410 nm and the assumption that the extincti...

Ngày tải lên: 17/03/2014, 10:20

7 475 0
Báo cáo khoa học: "Exploiting Feature Hierarchy for Transfer Learning in Named Entity Recognition" ppt

Báo cáo khoa học: "Exploiting Feature Hierarchy for Transfer Learning in Named Entity Recognition" ppt

... tuning), using the previously trained prior for regularization If we are unable to find a match between features in the training and tuning datasets (for instance, if a word appears in the tuning ... Learning on the test data: Leveraging ‘unseen’ features In Proc Twentieth International Conference on Machine Learning (ICML) Sebastian Thrun 1996 Is learning the n-th thing any eas...

Ngày tải lên: 23/03/2014, 17:20

9 384 0
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

... 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense primer, 5Â-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3Â; 2.5I antisense primer, 5Â-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ... claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3Â, was synthesized by Oper...

Ngày tải lên: 30/03/2014, 04:20

16 329 0
Mass Transfer in Chemical Engineering Processes Part 1 ppt

Mass Transfer in Chemical Engineering Processes Part 1 ppt

... 5.2 515 1. 1743 2 .18 83 4.9054 2.7 312 1. 6908 1. 5 711 3.9898 4. 616 5 1. 3 611 1. 5 017 4.5 018 2.6389 1. 9596 1. 8674 67 .14 75 32.23 31 16 .10 98 17 .0647 68.2393 43.06 61 23 .19 40 23.6572 13 .62 71. 78 363.2 255 11 .53 ... 0.0245 0.0229 0 .15 32 0.24 81 0 .11 55 0 .12 08 0 .10 84 0 .12 25 0 .10 35 0 .12 74 0 .19 81 0.3724 0 .16 66 0 .17 15 0 .15 94 0.24 31 0 .14 99 0 .18...

Ngày tải lên: 18/06/2014, 22:20

25 442 0
Mass Transfer in Chemical Engineering Processes Part 2 pdf

Mass Transfer in Chemical Engineering Processes Part 2 pdf

... (sec) 0.04 0. 02 0.00 3800 3600 3400 320 0 3000 28 00 -1 Wavenumbers (cm ) Fig 11 Intensity (H2O/AC/PMMA system) 26 00 24 00 34 Mass Transfer in Chemical Engineering Processes transferred into the cell, ... long cylinder or filament of radius r (Crank and Park, 1975, Jones, 1989) 20 Mass Transfer in Chemical Engineering Processes 1 .2 0.0 1.0 -0 .2 -10 -0.4 a 0....

Ngày tải lên: 18/06/2014, 22:20

25 709 0
Mass Transfer in Chemical Engineering Processes Part 3 docx

Mass Transfer in Chemical Engineering Processes Part 3 docx

... walls A preliminary design of a packed column involves the following steps: Choice of packing; Column diameter estimation; 42 Mass Transfer in Chemical Engineering Processes Mass transfer coefficients ... (1970) 44 Mass Transfer in Chemical Engineering Processes Ref: Henley & Seader (1981) Fig Random packing: (a) plastic pall rings (b) metal pall rings (Metal Hypa...

Ngày tải lên: 18/06/2014, 22:20

25 552 0
w