Novel bioactivity of furanochromene coumarin from psoralea corylifolia seeds and their synthetic analogues on skin fibroblast cells

Novel bioactivity of furanochromene  coumarin from psoralea corylifolia seeds and their synthetic analogues on skin fibroblast cells

Novel bioactivity of furanochromene coumarin from psoralea corylifolia seeds and their synthetic analogues on skin fibroblast cells

... constituents of the seeds of Psoralea corylifolia on skin cells Figure 2.1: Outline of experimental approaches to investigate the effects of selected constituents from the seeds of Psoralea corylifolia on ... Effect of Syn2 (6) on proliferation of human skin fibroblast cells (NF103, P6) .61 Figure 4.10: Effect of Fc-8b, Fc-8f, and Syn1 (5) on...

Ngày tải lên: 27/11/2015, 11:11

128 296 1
Báo cáo lâm nghiệp: "Small mammals of a forest reserve and adjacent stands of the Kelečská pahorkatina Upland (Czech Republic) and their effect on forest dynamics" pps

Báo cáo lâm nghiệp: "Small mammals of a forest reserve and adjacent stands of the Kelečská pahorkatina Upland (Czech Republic) and their effect on forest dynamics" pps

... of this forest stand and a certain level of resistance to the impact of small rodents in spite of unfavourable years of the total disposal of seed crop In addition to the effect of small mammals ... of small mammals thanks to the values of dominance and relative abundance A sufficient amount of data made it possible to monitor also the fluctuation of...

Ngày tải lên: 07/08/2014, 10:21

9 369 0
The ecology of the non native red eared sliders and their potential impacts on the native fauna of singapore

The ecology of the non native red eared sliders and their potential impacts on the native fauna of singapore

... and ecology of red- eared sliders in the wild in Singapore in order to make an assessment of the potential impacts on the local environment and in other parts of Southeast Asia; and b) Based on ... slider The impact of the red- eared sliders on the native species of Singapore is yet unknown Prior to this project no research had been carr...

Ngày tải lên: 10/09/2015, 15:50

272 273 0
Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of five novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx

Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of five novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx

... the same conditions, these apparent values can be used for comparison of binding afnities of the inhibitors under study The tting of the binding isotherms of all ve compounds with a binding model ... nitrogen and main and side-chain oxygen atoms of Ala59 and Glu61 of one subunit and with the main chain nitrogen of Asn114Â of the other subunit The...

Ngày tải lên: 07/03/2014, 11:20

15 439 0
Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Bifidobacterium longum and its complex with fructose pot

Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Bifidobacterium longum and its complex with fructose pot

... native enzyme and its complex with the product of hydrolysis – fructose The crystals of raffinose ($ 0.1 mg) were added to the crystallization drop with the apo crystals of b-fructofuranosidase ... of fructose The leaving group is carboxylate of Asp54 Dimerization The asymmetric units of the crystals of both the apo and complexed form of...

Ngày tải lên: 06/03/2014, 00:21

17 522 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity ... of peptides was assayed against several Gram-positive and Gram-negative bacteria using radial diffusion assay Petri dishes with Luria–Bertani agar were seeded with test bacteria T...

Ngày tải lên: 07/03/2014, 02:20

10 505 0
Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

... enzymes from Paenibacillus sp A11 (A11) and Bacillus macerans (BM) form CD7 and CD6 as their major products, respectively [13,14] The imprinting of the enzymes with CD8, resulting in high levels of ... comparison The effect of pH on the activity of the different CGTase preparations from A11 and BM was Table Degree of derivatization of the CGTases from A1...

Ngày tải lên: 07/03/2014, 10:20

10 562 0
Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf

Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf

... PRDX5 genes NRF2 is known to be involved in oxidative stress-induced activation of the PRDX1 gene in mouse macrophages [25] and mouse lungs [22] NRF2 is also involved in activation of many other ... NRF2 (Fig 3C,D) Role of PRDX5 in suppression of DNA oxidation (formation of 8-oxoG) To study the potential significance of PRDX5 in protection of the human ge...

Ngày tải lên: 30/03/2014, 11:20

11 463 0
Báo cáo Y học: Reconstitution of Fo of the sodium ion translocating ATP synthase of Propionigenium modestum from its heterologously expressed and purified subunits pdf

Báo cáo Y học: Reconstitution of Fo of the sodium ion translocating ATP synthase of Propionigenium modestum from its heterologously expressed and purified subunits pdf

... the conditions for the synthesis and the purification of individual Fo subunits of the Na+ -translocating ATP synthase of P modestum and their reconstitution into functional complexes These methods ... rapidly inactivated losing its potential for reconstitution into a functional Fo complex Reconstitution of functional Fo from its purified subuni...

Ngày tải lên: 31/03/2014, 15:20

7 333 0
Báo cáo khoa học: "A Probabilistic Model of Syntactic and Semantic Acquisition from Child-Directed Utterances and their Meanings" pot

Báo cáo khoa học: "A Probabilistic Model of Syntactic and Semantic Acquisition from Child-Directed Utterances and their Meanings" pot

... first to evaluate a model of child syntactic- semantic acquisition by parsing unseen data Models of child word learning have focused on semantics only, learning word meanings from utterances paired ... Work Models of syntactic acquisition, whether they have addressed the task of learning both syntax and semantics (Siskind, 1992; Villavicencio, 2002; Buttery, 2006) or sy...

Ngày tải lên: 31/03/2014, 20:20

11 403 0
báo cáo hóa học:" Low RBM3 protein expression correlates with tumour progression and poor prognosis in malignant melanoma: An analysis of 215 cases from the Malmö Diet and Cancer Study" potx

báo cáo hóa học:" Low RBM3 protein expression correlates with tumour progression and poor prognosis in malignant melanoma: An analysis of 215 cases from the Malmö Diet and Cancer Study" potx

... al.: Low RBM3 protein expression correlates with tumour progression and poor prognosis in malignant melanoma: An analysis of 215 cases from the Malmö Diet and Cancer Study Journal of Translational ... that the RNA- and DNA-binding protein RBM3 is an independent biomarker of a prolonged OS in patients with primary malignant...

Ngày tải lên: 20/06/2014, 04:20

9 388 0
Báo cáo hóa học: " Cellulose fibres, nanofibrils and microfibrils: The morphological sequence of MFC components from a plant physiology and fibre technology point of view" pptx

Báo cáo hóa học: " Cellulose fibres, nanofibrils and microfibrils: The morphological sequence of MFC components from a plant physiology and fibre technology point of view" pptx

... fraction of fibrillated fibres, (2) the fraction of nanofibrils and (3) the morphology of the nanofibrils in an MFC material Provided that a given MFC is composed of an appropriate fraction of individualised ... microfibrils: The morphological sequence of MFC components from a plant physiology and fibre technology point of view Nan...

Ngày tải lên: 21/06/2014, 03:20

7 569 0
Removal of heavy metals from wastewater using agricultural and industrial wastes as adsorbents

Removal of heavy metals from wastewater using agricultural and industrial wastes as adsorbents

... simultaneous removal of Fe, Pb and Ni, whereas fly ash was effective in the removal of Cd and Cu It was found that the percentage removal of heavy metals was dependent on the dose of low cost adsorbent and ... Cd removal using rice husk increased from 26.04% to 67.917% i.e with the increase of the amount of absorbent concentration, while the Cd removal usin...

Ngày tải lên: 20/07/2014, 12:47

7 675 0
báo cáo khoa học: "Emerging role of Garcinol, the antioxidant chalcone from Garcinia indica Choisy and its synthetic analogs" doc

báo cáo khoa học: "Emerging role of Garcinol, the antioxidant chalcone from Garcinia indica Choisy and its synthetic analogs" doc

... http://www.jhoonline.org/content/2/1/38 Figure from Garcinia indica Structure of Garcinol, Curcumin and compounds extracted Structure of Garcinol, Curcumin and compounds extracted from Garcinia indica detector and electrospray ... ethers The MOM and MEM ethers are cleaved in the presence of acid, under such conditions; and hence the side reactions comprom...

Ngày tải lên: 10/08/2014, 22:20

13 502 0
Báo cáo khoa học: "Temporal and geographic evidence for evolution of Sin Nombre virus using molecular analyses of viral RNA from Colorado, New Mexico and Montana" docx

Báo cáo khoa học: "Temporal and geographic evidence for evolution of Sin Nombre virus using molecular analyses of viral RNA from Colorado, New Mexico and Montana" docx

... characterization and analysis of isolation of Sin Nombre virus Journal of Virology 1995, 69:8132-8136 Huang C, Campbell WP, Means R, Ackman DM: Hantavirus S RNA sequence from a fatal case of HPS in New York ... test of7 neutrality (Fu and Li, 1993) for the M and S segments F test of neutrality (Fu and Li, 1993) for the M and S segments Only sequences from...

Ngày tải lên: 12/08/2014, 04:21

16 264 0
w