Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders
Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders
... source of cells and the potential to derive the cell type of interest together with the possibility to enrich for genetic modifications during the dividing stem cell state 1.1.1 Human pluripotent stem ... stem cells Landmark discoveries of the young field of human stem cell science were the isolation and culture of inner cell mass from hu...
Ngày tải lên: 26/11/2015, 09:54
Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation
... HUMAN EMBRYONIC STEM CELL- DERIVED NEURAL STEM CELLS: DERIVATION, DIFFERENTIATION AND MICRORNA REGULATION KWANG WEI XIN TIMOTHY (B.Sc (Hons), NUS) ... mechanisms of regulation of NSC differentiation 1.1.5.2 Pluripotent stem cell- derived NSCs Human embryonic stem cells (hESCs), which are pluripotent cells derived from the inner cell mass of blast...
Ngày tải lên: 10/09/2015, 09:08
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA...
Ngày tải lên: 09/09/2015, 18:56
cáo khoa học: " The European Society of Human Reproduction and Embryology guideline for the diagnosis and treatment of endometriosis: an electronic guideline implementability appraisal" ppsx
... Sweden, the Netherlands, and New Zealand Appraisal of the guideline We asked the panel members to read the ESHRE guideline for the diagnosis and treatment of endometriosis and to assess it with the ... and CM appraised the guideline with eGLIA and participated in the telephone conference and the revision of the manuscript RH participated in t...
Ngày tải lên: 10/08/2014, 10:23
Tài liệu Báo cáo khoa học: Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated fatty acids pdf
... cyclin D1 gene promoter We studied the mechanism(s) underlying the inhibition of cyclin D1 gene expression by EPA and DHA by examining the effects of n-3 and n-6 PUFAs incorporation on cyclin D1 promoter ... control of SMC proliferation 4466 S Bousserouel et al (Eur J Biochem 271) Modulation of cyclin D1 synthesis and hyperphosphorylation of Rb...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo y học: "Adipose-derived mesenchymal stem cells from the sand rat: transforming growth factor beta and 3D co-culture with human disc cells stimulate proteoglycan and collagen type I rich extracellular matrix" ppsx
... antibodies used in 3D immunohistological and CD marker studies Antibody Source Dilution Type I collagen Biodesign International (Kennebunk, ME) 20 μg/ml Type II collagen Biodesign International (Kennebunk, ... dimensional; CD, cluster of differentiation plastic adherence and lineage specific differentiation satisfy the standard criteria suggested for defining mesenchymal...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "HIV-1 and recombinant gp120 affect the survival and differentiation of human vessel wall-derived mesenchymal stem cells" pot
... HIV-1 and recombinant gp120 affect the survival and differentiation of human vessel wall-derived mesenchymal stem cells Retrovirology 2011 8:40 Submit your next manuscript to BioMed Central and ... muscle and endothelial cells To study the effects of HIV-1 on the differentiation of these cells, the interaction of HIV-1 and recombinant gp120...
Ngày tải lên: 13/08/2014, 01:20
Statistical methods for the detection and analyses of structural variants in the human genome
... STATISTICAL METHODS FOR THE DETECTION AND ANALYSES OF STRUCTURAL VARIANTS IN THE HUMAN GENOME TEO SHU MEI A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS GRADUATE SCHOOL FOR INTEGRATIVE ... analysis of the data could be more than the production of the data There is still a need for the development of new statistical/ bioinfo...
Ngày tải lên: 09/09/2015, 10:14
Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc
... safety in the healthcare environment through appropriate use of PPE PPE Use in Healthcare Settings: Program Objectives • Provide information on the selection and use of PPE in healthcare settings ... safely don and remove PPE PPE Use in Healthcare Settings The objectives of this program are to provide information on the selection and use...
Ngày tải lên: 08/03/2014, 13:20
Thuốc chống viêm ức chế lipooxygenase và cyclooxygenase dùng dự phòng và điều trị ung th- (LOX an COX - inhibitors as adjunctive therapies in the prevention and treatment of cancer) ppt
... G1 , ức chế tyrosin - kinase, ngăn chặn hoạt tính protein - ras In vitro, quercetin ức chế tyrosin - kinase ngời ung th, ức chế phát triển khối u, làm tăng thời gian sống sót động vật mang u ... tranh với acid arachidonic vị trí hoạt hoá LOX COX, cạnh tranh hạn chế tổng hợp prostanoid tiền viêm leucotrien - Mỡ cá ức chế đặc hiệu COX2 - Mỡ cá ức...
Ngày tải lên: 20/03/2014, 03:20
Clinical practice guideline for the assessment and prevention of falls in older people doc
... prepare clinical guidelines for the NHS in England and Wales for the assessment and prevention of falls, including recurrent falls in older people; with an associated clinical audit system Clinical ... s Clinical practice guideline for the assessment and prevention of falls in older people This guideline was commissioned by the N...
Ngày tải lên: 28/03/2014, 16:20
UPDATES IN THE DIAGNOSIS AND TREATMENT OF VASCULITIS pot
... IL-1β=Interleukin-1 Beta Updates in the Diagnosis and Treatment of Vasculitis 4.3 Monocyte activation and production of pro-inflammatory cytokines Wickman et al compared monocytes and cytokine profiles ... usually detectable in the serum and affected tissues in these diseases 15 16 Updates in the Diagnosis and Treatment of Vasculitis IL-6, TNF-α,...
Ngày tải lên: 30/03/2014, 00:20
Updates in the Diagnosis and Treatment of Vasculitis Edited by Lazaros I. Sakkas and Christina Katsiari pptx
... Updates in the Diagnosis and Treatment of Vasculitis http://dx.doi.org/10.5772/46068 Edited by Lazaros I Sakkas and Christina Katsiari Contributors Reem Hamdy Mohammed, Lazaros Sakkas, ... IL-1β=Interleukin-1 Beta Updates in the Diagnosis and Treatment of Vasculitis 4.3 Monocyte activation and production of pro-inflammatory cytokines Wickma...
Ngày tải lên: 30/03/2014, 18:20
Guidelines for the Diagnosis and Management of Food Allergy in the United States docx
... GUIDELINES FOR ThE DIAGNOSIS AND MANAGEMENT OF FOOD ALLERGY IN ThE UNITED STATES How were the Guidelines developed? The Guidelines are the culmination of a 2-year effort in which the National Institute ... National Institute of Allergy and Infectious Diseases Guidelines for the Diagnosis and Management of Food Allergy in th...
Ngày tải lên: 31/03/2014, 13:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx
... necessary for the training of field veterinarians This workshop information and the lectures were used to run workshops for the field veterinarians in the South and Centre of Vietnam and this information ... improve the diagnostic capability of the Veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and...
Ngày tải lên: 22/06/2014, 12:20