Characterization of arabidopsis myotubularins AtMTM1and AtMTM2 from development to stress adaptation
... location from the nucleus to the cytoplasm Cellular level of PtdIns5P is increased upon exposure of Arabidopsis to drought stress The transcript level of plantspecific transcription factor WRKY70 ... respectively Effects of ABA will be checked on the mutants of myotubularins and also investigate the effect of myotubularins on the production of ROS Loss of AtMTM1...
Ngày tải lên: 25/11/2015, 14:53
... number of Arabidopsis transcripts are potential targets for regulation by the PUF family of proteins The results obtained reveal a molecular conservation of PUF proteins in Arabidopsis thaliana and ... regarding the binding specificity of the subset of group I APUM proteins, showing that A thaliana has at least six PUF proteins with conserved RNA -binding...
Ngày tải lên: 18/02/2014, 06:20
... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotid...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... A novel high-activity D-hydantoinase from Jannaschia sp CCS1 obtain optically pure amino acids, namely chemical and enzymatic syntheses Chemical synthesis gives racemic mixtures of amino acids ... precipitate fraction; sup, supernatant fraction The molecular weight standard (lane M) is indicated on the right A novel high-activity D-hydantoinase from Jannaschia sp...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt
... 5¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ 5¢-CCATCACAAGAAACTAGAGAAAC-3 5¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ 5¢-CGAGCTCACTGCCTCTCAAC-3¢ 5¢-ACTCGTAGC-ACAGAGACAGAG-3¢ 5¢-ATGGCAGTAGTAGCAG-CTCC-3¢ 5¢-TCAGGTGTCT-AAGTTCAGAGATTC-3¢ ... Remarks 10 11 12 13 5¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ 5¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ 5...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... brassicae CSPMbraA6 [32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... of heterologous ASP3c in P pastoris MALDI-TOF mass spectrum of recombinant ASP3c (Fig 4) showed a major Fig MALDI-TOF mass spectrometry analysis of the recombinant ASP3c secreted by Pichi...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf
... 4779 Characterization of PDI from Conus marmoreus Z.-Q Wang et al A B Fig Comparison of amino acid sequences of PDIs from C marmoreus and other species (A) Multiple sequence alignment of PDIs from ... Catalysis of protein folding by protein disulfide isomerase and small-molecule mimics Antioxid Redox Signal 5, 413–424 Song JL & Wang CC (1995) Chaperone-like...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Characterization of membrane-bound prolyl endopeptidase from brain ppt
... amounts of protein loaded onto gels were as follows: for the PSD95 blot, 70 lg of TM, 96 lg of LM, 89 lg of MM, and 93 lg of HM; for the calnexin blot, 70 lg of TM, 96 lg of LM, 89 lg of MM, and ... (2002) Distribution of prolyl endopeptidase activities in rat and human brain Neurochem Int 40, 337–345 Agirregoitia N, Casis L, Gil J, Ruiz F & Irazusta J (2007) Ontogeny...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: Characterization of myo-inositol hexakisphosphate deposits from larval Echinococcus granulosus pdf
... of a calcium salt of myo-inositol hexakisphosphate in larval Echinococcus granulosus J Cell Biochem 93, 1271– 1281 10 Morseth DJ (1967) Fine structure of the hydatid cyst and protoscolex of Echinococcus ... Formation of solids is an important aspect of InsP6 biology, the understanding of which is still incomplete In this article, we addressed this issue for InsP6 de...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
... control of 30 s at 95 °C, 30 s at 50 °C and at 72 °C with a preheat at 95 °C and a 10 final extension at 72 °C using primers, S1 (5¢-GCAAATGCAACTGGA AGCGG-3¢) and A1 (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) ... (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢) and A2 (5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification of HRT2 The PCR prod...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Molecular characterization of H2O2-forming NADH oxidases from Archaeoglobus fulgidus potx
... that the three NADH oxidases belong to different phylogenetic clusters NoxA-1 falls within a group of typical NADH oxidases of 49 kDa, including the well-studied NADH oxidases from Enterococcus ... purification of especially NoxA-1, it was observed that the yellow colour of the enzyme fractions gradually disappeared From the UV/visible spectrum of Ó FEBS 2003 H2O2-...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... highest identity with the BAS1 protein of Brassica, spinach, barley and A thaliana, PR1 of Phaseolus and MHF of A thaliana These proteins belong to the 2Cys-Prx subfamily All plant 2Cys-Prx proteins, ... very weak when Trx m from Chlamydomonas was used (data not shown), probably because of the weaker af®nity of Arabidopsis NTR for Trx m [21] Therefore, the ability of T...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx
... exclusively of AATs from prokaryotes, including AATs from proto- Identification of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type ... mean ± SD of three determinations B subtilis B3 AATB3 Substrates L -aspartate L-glutamate a- ketoglutarate Oxaloacetate Fig Characterization of the purifi...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx
... nucleotide sequence of oyster CaLP cDNA obtained by RACE, a PCR reaction was performed using a pair of specific primers P3 (5¢-GGAAGAATACAGACACGGACAG-3¢) and P4 (5¢-ATAACAACAGTTTATACATCGCTTC-3¢) corresponding ... metabolism and calcium signaling pathways Experimental procedures RNA preparation and cDNA synthesis Adult specimens of P fucata were purchased from Guofa P...
Ngày tải lên: 16/03/2014, 23:20