Relevance of mineral nutrition and light quality for the accumulation of secondary metabolites in centella asiatica and hydrocotyle leucocephala

Relevance of mineral nutrition and light quality for the accumulation of secondary metabolites in centella asiatica and hydrocotyle leucocephala

Relevance of mineral nutrition and light quality for the accumulation of secondary metabolites in centella asiatica and hydrocotyle leucocephala

... lignan hinokinin, was examined in leaves and stems of H leucocephala The results ascertained in the single chapters can be summarized as follows: The higher levels of N, P, or K supply (in the range ... development of new drugs So far, neither there is information on the propagation and cultivation of the species, nor on the significance of growth conditions...

Ngày tải lên: 19/11/2015, 16:47

149 319 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... susceptible insects In this work, we characterized the binding of PA1b to a proteinaceous component of a particulate fraction of S oryzae extracts The binding was saturable and reversible, and the binding ... absence of the molecular target Indeed, the absence of binding in resistant strains could be due to the absence of the target protein, or to a...

Ngày tải lên: 08/03/2014, 02:21

7 605 0
semantic web for the working ontologist effective modeling in rdfs and owl

semantic web for the working ontologist effective modeling in rdfs and owl

... Semantic Web for the Working Ontologist Second Edition This page intentionally left blank Semantic Web for the Working Ontologist Effective Modeling in RDFS and OWL Second Edition ... products, instructions, or ideas contained in the material herein Library of Congress Cataloging -in- Publication Data Allemang, Dean Semantic Web for the working...

Ngày tải lên: 31/05/2014, 01:56

369 2,1K 1
Báo cáo sinh học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot

Báo cáo sinh học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot

... and R52 participates in the binding of Tat to TAR and is involved in the nuclear localisation of Tat [18,19] The strong or total suppression of transactivation abilities observed in many of the ... selection of multiple nonsynonymous mutations in tat in a unique epidemiologically-linked cohort following transmission of HIV-1 Comparisons of the...

Ngày tải lên: 18/06/2014, 18:20

5 317 0
Báo cáo hóa học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot

Báo cáo hóa học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot

... and R52 participates in the binding of Tat to TAR and is involved in the nuclear localisation of Tat [18,19] The strong or total suppression of transactivation abilities observed in many of the ... selection of multiple nonsynonymous mutations in tat in a unique epidemiologically-linked cohort following transmission of HIV-1 Comparisons of the...

Ngày tải lên: 20/06/2014, 01:20

5 268 0
Báo cáo toán học: "A formula for the bivariate map asymptotics constants in terms of the univariate map asymptotics constants" pps

Báo cáo toán học: "A formula for the bivariate map asymptotics constants in terms of the univariate map asymptotics constants" pps

... (3) In [21], a nice asymptotic formula was also derived for vg using the above recursion for vg and the asymptotic expression for ag the electronic journal of combinatorics 17 (2010), #R155 In ... expression for p1/2 (r) agrees with that given in [4, Theorem 1] Concluding remarks In this paper, we derived a simple expression for the coefficients tg (r) (pg (r)) in...

Ngày tải lên: 08/08/2014, 12:23

14 333 0
Báo cáo y học: " Adipose tissue transcriptomic signature highlights the pathological relevance of extracellular matrix in human obesity" pot

Báo cáo y học: " Adipose tissue transcriptomic signature highlights the pathological relevance of extracellular matrix in human obesity" pot

... secretion of proinflammatory cytokines Interstitial fibrosis *extracellular matrix Figure obese WAT place in 15 A sketch of the hypothetical map of pathophysiological interactions taking A sketch of the ... exclude the role of mature adipocytes in the excessive synthesis of some ECM components We formulated the hypothesis that pre-adipocytes in the presence o...

Ngày tải lên: 14/08/2014, 08:20

32 429 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects telome...

Ngày tải lên: 14/08/2014, 21:20

17 432 0
The Natural Functions of Secondary Metabolites

The Natural Functions of Secondary Metabolites

... intermediates of the shikimic acid pathway, the tricarboxylic acid cycle, and from amino acids The regulation of the biosynthesis of secondary metabolites is similar to that of the primary processes, ... are often critical for their accumulation and in this sense, their accumulation resembles that of secondary metabolites Despite the thousands of secondary m...

Ngày tải lên: 26/10/2013, 02:20

39 605 0
Using games for the 10th form speaking clas in high school (the new textboook) = sử dụng trò chơi trong giờ học nói tiếng anh lớp 10 ở trường trung học phổ thông   SGK mới

Using games for the 10th form speaking clas in high school (the new textboook) = sử dụng trò chơi trong giờ học nói tiếng anh lớp 10 ở trường trung học phổ thông SGK mới

... designed for the research into Using Games for the 10th Form Speaking Class in High School (The New Textbook)" Your cooperation in answering the following questions is highly appreciated This is for ... An in particular, the author has attempted to conduct the study entitled "Using Games for the 10th Form Speaking Class in High School...

Ngày tải lên: 19/12/2013, 11:30

59 2,4K 5
MECHANICAL ENABLING FOR THE INTEL@ PRNTIUM 4 PROCESSOR IN THE 478-PIN PACKAGE pdf

MECHANICAL ENABLING FOR THE INTEL@ PRNTIUM 4 PROCESSOR IN THE 478-PIN PACKAGE pdf

... Pentium® Processor 47 8-Pin Socket (mPGA478) Design Guidelines Assembling Intel Reference Components for the Intel® Pentium® Processor in the 47 8-Pin Package The following collateral is available in the ... Overview Mechanical Enabling Reference Design is: Intel-developed enabling solution for the Intel® Pentium® processor in the 47 8-pin package and...

Ngày tải lên: 09/03/2014, 00:20

25 361 0
w