a model for studying production of secondary metabolites

... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral gene family ... collected, and an effort to make available sets of sequences for use as molecular markers for snakes (for example, microsatellite primers and orthologous loci for use in phylogenetics and other applications)...

Ngày tải lên: 09/08/2014, 23:20

... the parser has to simultaneously perform two tasks: Searching for a path to be analysed and analysing it as well If the analysis procedure is too liberal, it may already accept and analyse an ungrammatical ... semantic predicates, a list of scopal constraints, syntactic, prosodic and pragmatic information as well as tense and aspect and sortal information An example of a VIT for the sentence Montag ist gut ... length and coverage of the individual analyses The length is defined as the length of the temporal interval an analysis spans; an analysis with a greater length is preferred The coverage of an analysis...

Ngày tải lên: 17/03/2014, 07:20

... http://scholar.sun.ac.za democracy, can help parliaments to become more transparent, accessible, accountable and effective in promoting democracy e-Parliament enables automation of parliamentary information ... many parliaments lack a strategic plan, an adequate ICT infrastructure, basic tools for Members of Parliament and staff, systems for managing documents and trained ICT staff The status of the ... virtual forums for debate, can provide a platform for freedom of speech and a channel through which representatives can be contacted, engaged with and influenced As yet this form of e-democracy has...

Ngày tải lên: 10/05/2014, 16:26

... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric ... conceptualization has also been used to develop a five-compartment anatomical model (brain, liver, kidney, heart and all other organs) as an explanation for Kleiber's law [28] The anatomical con- Page ... midpoint of the values of ki plus the midpoint of the values of bi because values of ki are not available for certain tissues For scaling of the brain and the epithelial tissues of the skin and gastrointestinal...

Ngày tải lên: 13/08/2014, 23:20

... S., Gautam, A. , Sahrma, A. , Batra, A. , 2010 Centella asiatica (L.): a plant with immense medicinal potential but threatened International Journal of Pharmaceutical Sciences Review and Research ... compounds of asiaticoside and asiatic acid (Sigma Aldrich, St Louis, Missouri, USA) and are in agreement with published data (Mauri and Pietta, 2000; Rafamantanana et al., 2009) The concentrations of ... and light quality on the accumulation of pharmaceutically relevant secondary metabolites, particularly saponins and lignans, using Centella asiatica and Hydrocotyle leucocephala as examples Experiments...

Ngày tải lên: 19/11/2015, 16:47

... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... the subgrade Among these material properties, those associated with asphalt concrete and subgrades are known to fluctuate seasonally Therefore seasonal evaluation of pavement material properties ... Strategic Highway Research Program (SHRP) through United States and Canadian pavement data base (DataPave online version release-18, 2004;http://www.datapave.com) Secondly, statistical and probabilistic...

Ngày tải lên: 04/07/2016, 17:20

... accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of [LaH] and pH at each time point during growth is necessary According ... Nicolaı ¨ et al (1993) Nicolaı et al (1993) have constructed a dynamic ¨ model for the surface growth of lactic acid bacteria on vacuum-packed meats In the current research, the model is adapted ... medium and associated initial pH is not a variable in the case study presented in this paper, lmax and pmax can be reasonably assumed constant Among microbiologists it is widely accepted that metabolites...

Ngày tải lên: 05/05/2014, 08:44

... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...

Ngày tải lên: 12/08/2014, 23:23

... use of these underestimated bacterial aggregates as intriguing models for the analysis of protein–protein interactions in the context of amyloid and prion diseases Dynamics of IB formation and ... amyloid formation pathways, any sequence able to be accommodated in a b-sheet conformation can, potentially, reach the amyloid state [51,56] Amyloid-like properties of bacterial IBs Protein aggregation ... E Garc a- Fruitos et al Biological role of bacterial inclusion bodies A B Fig A nucleation ⁄ polymerization selfassembly process drives the formation of IBs in bacteria (A) In vivo formation of...

Ngày tải lên: 06/03/2014, 00:20

... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... International Conference on Computational Linguistics, pp.218-224 COLING-ACL’98 Lance A Ramshaw and Michael P Marcus ( In Press) Text chunking using transformation-based learning In Natural Language ... sequences, parameters (3) and (4) can be calculated, The calculation formulas are similar with equations (13) and (14) respectively Before training trigram model (3), all possible baseNP rules...

Ngày tải lên: 08/03/2014, 05:20

... occupy an area of 40 ha, of which 27 are planted with native Australian plants Most of the remainder is natural woodland, which is contiguous with the woodland of Canberra Nature Park The birds are ... was used on group size and territory quality (categorical variables), and male age and age squared (continuous variables) Age and age-squared were used in case the effect of male age was not a ... natal philopatry of males, although occasionally males immigrate into groups as subordinates ( Magrath & Whittingham 1997) Females always disperse from their natal group before or at the onset of...

Ngày tải lên: 14/03/2014, 16:20

... QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC GGT GAT ... Genomics) for running many of the analytical ultracentrifugation samples, A Padovani for making the W56F variant and J A Kornblatt for encouragement and advice Financial support was provided by the Natural ... temperature denaturation, any change at these positions was destabilizing G37 6A and G376E had identical Tm values At position 157, alanine had a smaller effect than aspartate, but even alanine decreased...

Ngày tải lên: 16/03/2014, 06:20

... designated as a a, head±tail, and b±b The a a dimer has a diad and is characterized as helix-helix packing between the two monomers, as shown in Fig 2A The head±tail dimer is formed by a crystallographic ... (1993) Interaction between staphylokinase, plasmin(ogen), and alpha2-antiplasmin Recycling of staphylokinase after neutralization of the plasmin-staphylokinase complex by alpha2-antiplasmin J Biol ... 1.4 A added to the van der Waals radius Dimer model Buried surface Ê area (A2 ) Hydrogen bonds Salt bridges A 77Arg A 65Glu A 65Glu A 61Glu A 58Glu None P212121 a a 1009 A 65Glu OE1±B 62Tyr OH, A...

Ngày tải lên: 23/03/2014, 21:21

... neither photoaf®nity labeled by a dioxin analog, nor activated by b-naphto¯avone in a yeast system [20]; the rainbow trout AhRa that binds TCDD [21] and the Microgadus Tomcod AhR also activated by ... 13 Altschul, S.F., Madden, T.L., Scha€er, A. A., Zhang, J., Zhang, Z., È Miller, W & Lipman, D.J (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs Nucleic Acids ... RESULTS AND DISCUSSION Structure prediction Application of a recursive PSI-BLAST [13] search (default parameters) against the nonredundant protein sequence database revealed a high number of matches...

Ngày tải lên: 24/03/2014, 00:21

... observed  values  of various  wave  characteristics,  it  can  be  remarked  that  the  numerical  model can  simulate  wave  transformation  in  the  nearshore  region  with  an acceptable accuracy.  ... the coastal structures.   Zero  gradients  of k   and  ε   are  assumed  at  the  offshore,  lateral  boundaries  and  at  surfaces of coastal structures.  A scheme  similar  to  that  of Hibberd  ... the  simulation  of the  wave  transformation  on  a natural  beach,  existing  experimental data on the wave dynamics in  the  nearshore  area  obtained  by  Ting  and  Kirby  [15‐17]  are  used. ...

Ngày tải lên: 28/03/2014, 15:20

... The associative tasks are carried out centrally by a national association of the savings banks In addition, the savings bank group consists of around 450 local savings companies at its disposal ... local savings associations, 34 regional savings banks, National Bank of the savings banks) Tripartite (519 local savings banks, 12 regional state banks, DekaBankDeutsche Girozentrale) Coordinating ... the reform of 1999 is transferable to these countries and can act as a model for them Comparing the structural features of French and German savings banks Structural feature France Germany Proprietor...

Ngày tải lên: 29/03/2014, 08:20

... Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ , Jan Stˇ p´ nek, Pavel Straˇ ... Role-less Argument Bias Problem For learning of the model, we borrow a fundamental idea of Kazama and Torisawa’s perceptron learning algorithm However, we use a more sophisticated online-learning algorithm ... plausible set of assignments of a predicate sense and its argument roles simultaneously We present an exact inference algorithm for the model, and a large-margin learning algorithm that can handle...

Ngày tải lên: 30/03/2014, 21:20

... health such as alanine transaminase (ALT) and aspartate transaminase (AST) function increased as the MARV disease progressed (Figure 2E–F) As shown by the total Page of 13 (page number not for ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to ... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants...

Ngày tải lên: 18/06/2014, 18:20

... health such as alanine transaminase (ALT) and aspartate transaminase (AST) function increased as the MARV disease progressed (Figure 2E–F) As shown by the total Page of 13 (page number not for ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to ... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants...

Ngày tải lên: 20/06/2014, 01:20

... design and performance evaluation of tracking capabilities of the proposed algorithms for indoor localization The parameters of the Markov model are analytically derived from the results of the ... among different classes of ranging errors, back and forth, as it keeps moving Such spatial correlation and change of class can easily be modeled with Markov chains 4.1 Ranging states of the Markov ... Orleans, La, USA, March 2003 [40] N A Alsindi, B Alavi, and K Pahlavan, “Measurement and modeling of UWB TOA-based ranging in indoor multipath environments,” 2007, to appear in IEEE Transactions...

Ngày tải lên: 22/06/2014, 06:20