Characterization of adiponectin at different physiological s

Characterization of adiponectin at different physiological states in cattle based on an in house developed immunological assay for bovine adiponectin

... supplementation on blood and tissue adiponectin concentrations, and 3) To evaluate the effect of lactational and dietary induced negative energy balance on blood and milk adiponectin concentrations Manuscript ... expression of adiponectin mRNA and protein in different sc and visceral AT depots and their relationship with blood adiponectin concentration 4.4 Correlations...

Ngày tải lên : 19/11/2015, 16:40

139
132
0

Identification and biochemical characterization of tetrahydrolipstatin targets in m bovis BCG at different metabolic states

... transform-mass spectrometry m/ z mass by charge ratio MAG Monoacylglycerol MBC Minimal bactericidal concentration MIC50 Minimum inhibitory concentration required to inhibit the growth of 50% of organism ... and ineffective against latent bacilli20 As of 2010, the recommended treatment for active TB is minimum six months of a combination of four antibiotics containing rifampicin,...

Ngày tải lên : 09/09/2015, 10:07

184
247
0

Characterization of new peptides and physiological amino acids present in cerebrospinal fluid of chronic pain patients

... pain patients Vs Citrulline negative labor pain patients 78 3.3 Correlation between Pain intensity (PI) and the concentration of Pain related amino acids in cerebrospinal fluid of the labor pain ... nitric oxide in acute labor pain Applying our new method for amino acid analysis in CSF to analysis of physiological amino acids and other pain...

Ngày tải lên : 12/09/2015, 09:55

218
264
0

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... 1 H NMR of mobile lipids in tumour cells A M Luciani et al MCF-7 cells from human cancers In a previous study [13], we demonstrated that these cells display intensity modulation of ML signals ... provided in Fig 1B (insert), which shows the characteristic cross peak from the geminal protons of carbons and of glycerol in TG [1] Cross peaks of lipids, includ...

Ngày tải lên : 18/02/2014, 13:20

14
765
0

Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

... (S)-cheilanthifoline, not (S)-nandinine [7,30,31] If we assume that (S)-nandinine is produced in E californica, there may be no need for a catalyst from (S)-nandinine to (S) -stylopine However, nandinine could ... 1029 Stylopine synthase from Eschscholzia californica N Ikezawa et al E californica [27] Indeed, CYP80B1 has been cloned using this strategy, although other P450s invol...

Ngày tải lên : 07/03/2014, 10:20

17
376
0

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... product of the second round of PCR was cloned and the 1066 bp sequence encoding 125 amino acids of the A-chain, the 19 amino acids linker, and 216 amino acids of the B-chain of the ml gene was obtained ... (Met153 of the ML1p and ML2p B-chains and Met156 of the ML3p B-chain corresponding to the ricin B-chain Leu152; and Met234 of the ML1p and...

Ngày tải lên : 07/03/2014, 15:20

11
610
0

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên : 07/03/2014, 16:20

12
772
0

Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

... within negatively stained particles of artemin indicated the lack of metal storage capacity Function of an Artemia ferritin homolog A B C Artemin, apoferritin and ferritin inhibit citrate synthase ... denaturation Artemin, apoferritin and ferritin protected citrate synthase against denaturation at 43 °C in a concentrationdependent manner (Fig 3A C) Maximal protec...

Ngày tải lên : 16/03/2014, 11:20

9
434
0

Báo cáo khoa học: Transcriptional responses to glucose at different glycolytic rates in Saccharomyces cerevisiae ppt

... display a wide spectrum of glucose uptake rates These strains are therefore useful for investigating the effects of different glycolytic rates on glucose- induced signalling pathways For this study ... 5A), indicating that the protein was phosphorylated to a different extent and was partially inactive as a repressor Interestingly, Mig1 from cells growing in the presence of 0....

Ngày tải lên : 16/03/2014, 18:20

10
309
0

Báo cáo khoa học: Characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans docx

... the identiﬁcation and characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans We show that these enzymes are heterotetramers, like the decaprenyl diphosphate synthase ... synthases in mice and humans need two proteins (i.e both mSPS1 and mDLP1 or both hDPS1 and hDLP1, respectively) to be active The success of reconstitu...

Ngày tải lên : 16/03/2014, 23:20

17
346
0

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... kept at °C and used within 10 days Quantification of alkaline phosphatase and aminopeptidase activities Specific alkaline phosphatase (ALP) and N-aminopeptidase (APN) enzymatic activities of BBMV ... sugar Canavalis ensiformis (ConA) a- Man a- Glc Galb1 fi 3GalNAc Galb1 fi 3,4GlcNAc a/ bGalNAc a/ bGal Galb1 fi 4GlcNAc Gala1 fi 3Gal GalNAca1 fi 3GalNAc GalNAca1 fi 3Gal Galb1 fi 3G...

Ngày tải lên : 23/03/2014, 13:20

9
399
0

Báo cáo khoa học: Quenched hydrogen ⁄deuterium exchange NMR characterization of amyloid-b peptide aggregates formed in the presence of Cu2+ or Zn2+ ppt

... to morphologically distinguish aggregates formed in the presence of Cu2+ from those formed in the presence of Zn2+ Taken together, these results suggest that Ab aggregates formed in the presence ... aggregates formed in the presence of Cu2+ [(i) and (iii)] or Zn2+ [(ii) and (iv)], or as ﬁbrils formed in the presence of EDTA [(v...

Ngày tải lên : 30/03/2014, 01:20

10
294
0

Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

... designated P2Y12 [15–17] Results from our laboratory revealed that both classic P2Y1 and P2Y12 receptors coexist in glioma C6 cells: P2Y1, linked to phospholipase C, and P2Y12 , inhibiting adenylate ... and P2Y1 and P2Y12 receptor protein expression and functional activity Examination of the effects of speciﬁc pharmacological agents (a single agonist a...

Ngày tải lên : 30/03/2014, 08:20

13
378
0

Báo cáo khoa học: Biochemical characterization of the minimal polyketide synthase domains in the lovastatin nonaketide synthase LovB pot

... that the individual domains of the megasynthase may remain folded despite the lack of the KS dimer Minimal polyketide synthase domains in LovB Characterization of the standalone MAT protein The LovB ... in the yield of the soluble protein Pantetheinylation of the ACP in ACPCON didomain was veriﬁed using MALDI-TOF of a tryptic fragment of...

Ngày tải lên : 30/03/2014, 08:20

11
558
0

Báo cáo khoa học: "Comparison between the structure and function of chloroplasts at different levels of willow canopy during a growing season" ppsx

... rates of C0 A uptake recorded (Fig 2A) were possibly caused by decreased availability of excitation energy in the canopy and not by altered organization of thylakoid membranes Later in the growing ... be an indication of ageing (Hudak, 1981) .The pattern of thylakoid organization at level (110 cm aboveground) was similar to that at level 1; only the appressed/non-...

Ngày tải lên : 09/08/2014, 03:24

4
332
0