The implication of microglial sialic acid binding immunoglobulin like lectin e (siglec e) in neuroinflammation

... Overexpression and knock-down of Siglec -E led to an increase and decrease in relative neurite length, respectively The neuroprotective effect of Siglec -E was abrogated after removal of the sialic ... Additionally to the before mentioned TLRs, complement, cytokine and chemokine receptors microglia express carbohydrate -binding receptors on their surface One family of the...

Ngày tải lên: 19/11/2015, 15:52

... Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemontii were collected from the local wetlands of Kanyakumari district, India The crabs used for experimental purpose were of either ... (1985) Purification and characterization of an O-acetyl sialic acid specific lectin from a marine crab Cancer antennarius J Biol Chem 260, 8850–8856 13...

Ngày tải lên: 21/02/2014, 00:20

... detection of cellular retinoic acid binding proteins I and 3570 R.-Z Liu et al 15 16 17 18 19 20 21 22 23 24 25 26 27 28 II with new antibodies J Histochem Cytochem 46, 11 03 11 11 Zetterstrom RH, Lindqvist ... (19 90) Retinoic acid receptors and cellular retinoid binding proteins I A systematic study of their differential pattern of transcription during mouse organo...

Ngày tải lên: 16/03/2014, 22:20

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...

Ngày tải lên: 07/03/2014, 12:20

... larger than the maximal O2 concentration in solution) [6–9] These enzymes appear to ‘consume’ O2 without highaffinity binding Because of the scarcity of information concerning the reaction of flavoproteins ... in the oxidized form, and the spectrum of the reduced enzyme is observed only at the end of the observation time, i.e when the O2 concentration becom...

Ngày tải lên: 28/03/2014, 23:20

... This study investigated the effects of Na SO4 additive in the positive electrode on the performance of VRLA cells Based on the results presented herein, we can conclude the following Ž1 The XRD ... composition is independent of the amount of Na SO4 additive in the positive electrodes Plate composition relies heavily on the cure temperature con...

Ngày tải lên: 05/07/2014, 21:20

... with increase of the phenolic content, whereas during the second test, the capacity depends but slightly on the phenolic group content The dependencies of U3000 and CCA capacity on the content of ... different impact on this parameter Another reason for the formation of these two regions can be the content of carboxyl groups in the lignin It...

Ngày tải lên: 05/07/2014, 21:20

... holo -liver fatty acid binding protein 14 2.1.2.2 Structural studies on apo -liver fatty acid binding protein 15 2.1.3 A brief summary 15 2.2 Characterization of the dynamics of fatty acid binding proteins ... holo-intestinal fatty acid binding protein 11 2.1.1.2 Structural studies on apo-intestinal fatty acid binding protein 12 2.1.2 Structural s...

Ngày tải lên: 11/09/2015, 09:59

... Definition of the language activities Language activities are activities that are used in teaching a language for teachers aims In speaking class, language activities are often exerted because the ... is the reality of the application of language activities in teaching speaking skill to 11th grade students in Pham Hong Thai school?...

Ngày tải lên: 18/12/2013, 10:03

... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... of all sub-domains at baseline and endpoint was robust against single missing items, as the alpha values did not decrease by any meaningful degree when one item was deleted The TA...

Ngày tải lên: 12/02/2014, 19:20

... photocopying, recording or otherwise) without the written permission of both the copyright owner and the author of the book Affluent in the Face of Poverty On What Rich Individuals Like Us Should Do ... JMP x Affluent in the Face of Poverty Introduction What Should Rich Individuals Like Us Do About Poverty? 1.1 The Central Q...

Ngày tải lên: 15/02/2014, 00:20

... be associated with resistance to pulmonary tuberculosis in the Chinese Han population KIR genes apparently have a role in resistance to pulmonary tuberculosis Key words: Pulmonary tuberculosis; ... those of Mendez et al (2006) Smear-positive patients are the main source of infection in a community Only 10% of individuals develop clinical disease The immune respons...

Ngày tải lên: 15/02/2014, 12:20

... substitution of D76 by asparagine or leucine resulted in nearly inactive mutants, whereas D76H exhibited about 10% of the wild-type activity of polysulđde respiration The hydroxyl groups of Y2 3 and Y1 59 ... encode the membrane anchor of the enzyme and to carry the site of quinol oxidation Tetrathionate reductase (Ttr) of Salmonella typhimurium is thou...

Ngày tải lên: 24/03/2014, 03:21

... Results Effect of UNG concentration on DNA degradation and RTPCR amplification of RNA To assess the effect of UNG on DNA degradation and RNA detection, reactions were performed under conditions recommended ... correspond to 1.5 – 3.7-fold decreases in detectible RNA Effect of incubation temperature and time on DNA degradation and RT-PCR amp...

Ngày tải lên: 19/06/2014, 08:20

... 93(2):221-5 Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement ... benefit of an increase in VO2 max future research should evaluate the implication of a higher intensity workplace exercise training programme on the modification of...

Ngày tải lên: 20/06/2014, 00:20