THE SPATIAL HETEROGENEITY AND ANOMALOUS DIFFUSIVITY IN SILACA LIQUID

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... to the 9th cycle from the N-terminus including the initiating Met: MHKTHSTMS for Sno1p and MTGEDFKIKS for Snz1p Properties of the complex of Sno1p and Snz1p When Sno1p with a His-tag and Snz1p ... SNO3, SNZ2 and SNZ3 complement the defect The relationship of all of these genes remains to be clarified Expression and purification of Sno1p and Snz1p In light...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of...

Ngày tải lên: 20/02/2014, 11:20

13 691 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Off the Rim Basketball and Other Religions in a Carolina Childhood docx

Off the Rim Basketball and Other Religions in a Carolina Childhood docx

... and I always saw the Series at the house of a friend who was a big Yankee fan and friends, at age eight, always being adversaries, I took the other side And if the Dodgers in the National League, ... why the Indians in the American? Because, I’m almost certain, of the ’54 World Series when the Indians played the Giants, 22 Off the Rim and as a Dodg...

Ngày tải lên: 08/03/2014, 16:20

260 492 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

... 3A) and ATP (Fig 3B) in the absence and presence of curcumin, using the coupled enzyme assay In Fig 3A, the half-maximal activation of the ATPase by Ca2þ was measured in the absence of and in the ... appear unlikely that curcumin can ‘occlude’ ATP binding, in the same way as chromium -ATP, by trapping the ATP in the binding site when...

Ngày tải lên: 08/03/2014, 23:20

10 594 0
Báo cáo khoa học: Curcumin suppresses the dynamic instability of microtubules, activates the mitotic checkpoint and induces apoptosis in MCF-7 cells ppt

Báo cáo khoa học: Curcumin suppresses the dynamic instability of microtubules, activates the mitotic checkpoint and induces apoptosis in MCF-7 cells ppt

... (Sigma) The band intensities were calculated using image j software Effects of curcumin on the dynamic instability of individual microtubules in MCF-7 cells The effects of curcumin on the dynamic instability ... off with fresh media The cells were incubated without or with curcumin for and h, and then stained with PI The effect of curcumin on t...

Ngày tải lên: 23/03/2014, 03:20

12 372 0
Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx

Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx

... Ackerman and John Moore 1999 Syntagmatic and Paradigmatic Dimensions of Causee Encodings Linguistics and Philosophy, 24:1–44 Avery D Andrews and Christopher D Manning 1999 Complex Predicates and Information ... shows another instance of the schema in (1), which is undefined for any of the combinators in (3): The preceding data motivates adding D rules (we return to...

Ngày tải lên: 31/03/2014, 00:20

9 360 0
báo cáo hóa học: " Factor structure of the Hospital Anxiety and Depression Scale in Japanese psychiatric outpatient and student populations" pdf

báo cáo hóa học: " Factor structure of the Hospital Anxiety and Depression Scale in Japanese psychiatric outpatient and student populations" pdf

... were imposed constraints, only two factor loadings in the The aim of the present study is to examine the factor structure of the HADS using Japanese psychiatric outpatient and student populations ... and the Hospital Anxiety and Depression Scale Br J Psychiatry 1990, 157:860-864 Dawkins N, Cloherty ME, Gracey F, Evans JJ: The factor structure...

Ngày tải lên: 18/06/2014, 18:20

9 534 0
báo cáo hóa học: " The minimal important difference of the hospital anxiety and depression scale in patients with chronic obstructive pulmonary disease" pot

báo cáo hóa học: " The minimal important difference of the hospital anxiety and depression scale in patients with chronic obstructive pulmonary disease" pot

... 0.5.[23] Using the regression equation and the minimal important difference of the anchors (0.5 points for the CRQ[15] and points for the FT[23]) we estimated the minimal important difference of the ... sizes of trials and to make treatment decisions without the understanding that the point estimate of 1.5 is the best estimate of the minimal...

Ngày tải lên: 18/06/2014, 19:20

6 486 0
báo cáo hóa học: " Methods to recognize work-related cancer in workplaces, the general population, and by experts in the clinic, a Norwegian experience" pptx

báo cáo hóa học: " Methods to recognize work-related cancer in workplaces, the general population, and by experts in the clinic, a Norwegian experience" pptx

... article as: Langård and Lee: Methods to recognize work-related cancer in workplaces, the general population, and by experts in the clinic, a Norwegian experience Journal of Occupational Medicine and ... up to the labor inspectorate, the insurance scheme and/ or specialists in occupational medicine, to clarify the work-relatedness of the...

Ngày tải lên: 20/06/2014, 00:20

10 390 0
báo cáo hóa học:" Assessment of the structure of the Hospital Anxiety and Depression Scale in musculoskeletal patients" pdf

báo cáo hóa học:" Assessment of the structure of the Hospital Anxiety and Depression Scale in musculoskeletal patients" pdf

... outcome One of the issues facing clinicians wishing to screen for high levels of anxiety and depression among their patients is the choice of a screening tool In a hospital setting, the tool needs ... common in patient populations The HADS consists of an anxiety and depression subscale, each containing seven items, making it quick and easy to use in clini...

Ngày tải lên: 20/06/2014, 15:20

9 541 0
báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc

báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc

... findings of the factor structure of the Chinese version of the HADS in Cantonese-speaking Chinese CHD patients in Hong Kong indicates clear and consistent superiority of three-factor models in ... detection utility and accuracy [16] The present study was designed to examine the underlying factor structure of the Chinese version of the HADS in...

Ngày tải lên: 20/06/2014, 15:20

5 393 0
Báo cáo lâm nghiệp: "Canopy structure and spatial heterogeneity of understory light in an abandoned Holm oak woodland" pps

Báo cáo lâm nghiệp: "Canopy structure and spatial heterogeneity of understory light in an abandoned Holm oak woodland" pps

... effect of land use change on the canopy structure and the understory light of a Holm oak woodland in central Spain The woodland studied had two distinct zones, one where the original woodland structure ... Canopy structure and understory light in two strata and two zones The Holm oak woodland studied was on average short (mean height of 2.4 m, mean height...

Ngày tải lên: 07/08/2014, 16:20

13 409 0
Báo cáo y học: " There has been a lack of investigation into the spatial distribution and clustering of suicide in Australia, where the population density is lower than " pot

Báo cáo y học: " There has been a lack of investigation into the spatial distribution and clustering of suicide in Australia, where the population density is lower than " pot

... the characteristics of each variable Spatial analysis was performed to view the spatial distribution of suicide ASM rates by gender and age, using GIS and mapping approaches Qi et al BMC Psychiatry ... interventions in Queensland, Australia This spatial analysis method may also have a wide application in mental health research and practices Abbreviations ABS: (A...

Ngày tải lên: 11/08/2014, 16:22

10 356 0
w