PHOTOSTIMULATED QUANTUM EFFECTS IN QUANTUM WELLS WITH a PARABOLIC POTENTIAL

... Doctor of Philosophy Optical time resolved spin dynamics in III-V semiconductor quantum wells Matthew Anthony Brand This thesis presents time- resolved measurements of the spin evolution of transient ... relaxation in InGaAs/InP was due the native interface asymmetry present in the structure or if spin relaxation is generally fast in InGaAs wells (see chapter...

Ngày tải lên: 06/04/2013, 10:57

... ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter ... protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP...

Ngày tải lên: 06/03/2014, 01:20

... into inflation expectations and inflation risk premia Due to a lack of data, we cannot this, and instead we estimate inflation forward rates as part of our model Vol No Estimating Inflation Expectations ... fit Inflation expectations as estimated in this paper have a number of advantages over using the inflation yield to measure expectations For example, five-year-a...

Ngày tải lên: 15/03/2014, 07:20

... ii ESTIMATING INFLATION EXPECTATIONS WITH A LIMITED NUMBER OF INFLATION-INDEXED BONDS Richard Finlay and Sebastian Wende Introduction Reliable and accurate estimates of in ation expectations are ... historical in ation Model-derived in ation expectations also have a number of advantages over expectations from market economists: unlike survey-based expectation...

Ngày tải lên: 22/03/2014, 20:20

... two datasets employed show that automatic or weakly supervised data acquisition, combined with automatic and manual feature selection to eliminate the skewed nature of the data obtained, is a good ... the automatically generated training data We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance for our maxent model, and constructed a dic...

Ngày tải lên: 31/03/2014, 00:20

... noisy speech Time-domain waveforms of (a) : Noise signal, (b): Residual signal after STP analysis, and (c): Residual signal after LTP analysis Table NCC between transient noise and residual signals ... residual signals after the STP analysis and the LTP analysis The input signal of the analysis contains both speech and transient noise to show the influence of the speech...

Ngày tải lên: 20/06/2014, 21:20

... vertical dashed lines indicate the value of a0 and the borderline of the QW, respectively Fig The change in spin-orbit splitting energy C as the position of the impurity under the linear Rashba model ... state is more localizing than the excited states in QWs These changing trends are found in Fig In summary, we proposed a linear Rashba model along the z directi...

Ngày tải lên: 22/06/2014, 01:20

... energies and wave functions of the ground and several excited electronic states of silicon quantum dot with a lithium donor that may be treated as a shallow hydrogenic one We shall also discuss an ... where jai denote the s-, p-, d-, states, and Cja are the expansion coefficients As was shown in Ref [26], in order to find energies and wave functions of a few lower stat...

Ngày tải lên: 22/06/2014, 18:20

... Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp 475 D D Ang, Stabilized aproximate solution of certain integral equations of first kind arizing in mixed problems of elasticity, ... contractive averaging, U.S Army Math Res ctr T S R 160 (1960) D D Ang, C D Khanh, and M Yamamoto, A Cauchy like problem in plane elasticity: a moment theoretic appr...

Ngày tải lên: 06/08/2014, 05:20

Ngày tải lên: 07/08/2014, 17:22

... end, CCR5 ligands mRNA expression increased in the aging thymus The CCR5 ligands, CCL4 and CCL5, increase in the thymic parenchyma as revealed by the age-associated increases in the staining of ... deposition, including unilocular adipocytes and multilocular cells Upper panels of Figure represent the thymus of 2, 12 and 21 month-old mice stained...

Ngày tải lên: 08/08/2014, 18:20

... twin pregnancy with a successful outcome for the healthy co -twin after early transient preeclampsia Case presentation A 33-year-old Caucasian woman, gravida 3, para 1, was admitted to our clinic ... still cause preeclampsia, but the preeclampsia can regress We conclude that, in the case of a twin pregnancy with a triploid fetus and early preeclampsia, t...

Ngày tải lên: 11/08/2014, 17:21

... components, each with at most n leaves, and such a node can be found in linear time in T such that each of the trees in T - {v} has at most n leaves An internal node v of T having such a property is called ... und Angewandte Mathematik 1869, 70:185-190 Kannan SK, Lawler EL, Warnow T: Determining the evolutionary tree using experiments Journal of Algorithms 1996, 21:26-50 Kao MY,...

Ngày tải lên: 12/08/2014, 17:20

... dietary input and vitamin status We plan to investigate the dynamic properties and potential interactions among the many methyltransferases that act in parallel using SAM as a substrate Finally, ... environmental, and behavioral variables interact to affect many aspects of health and disease [1-12] It has been known for almost 50 years that some reactions of the folate cycle in eukary...

Ngày tải lên: 13/08/2014, 16:21

... processing, any quantum system used for quantum information processing must allow efficient state initialization, manipulation and measurement with high fidelity, and efficient operation by a quantum gate ... detectors, light sources and optics are readily available (see Appendix A. 9 for the band gaps of various semiconductors) As QDs have a very large surface-to-volume ra...

Ngày tải lên: 11/09/2015, 09:06