point locations in an element with a text node child

... common disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence ... fracture site, allowing vascular regeneration and eliminating further damage to the peripheral and intramedullary blood supply which occurs during plate and screw fixation and intramedullary nailing ... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and...

Ngày tải lên: 20/06/2014, 04:20

... redundant folding possibilities and concentrate on predicting candidates for secondary structure conformation rearrangements that can cause inactivation of spectinomycin resistance in E coli An asterix ... performed in RNAMute, based on Shapiro and Zhang [18] described elsewhere, also calculates other distance information such as Shapiro and Zhang’s RNA tree distance [18] and the Vienna RNA distance ... CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGG A GCGGAUGUAUU UUGGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC CCCUGCCGUACCCGGGUCGAAUUCG ACCCCUUGUCUGGGGCGGAUGUAUU U A GGGAGGGUAGCUGGCGGAGG CCUCGGCCCAGGAAGCUAUGCAUGC...

Ngày tải lên: 22/06/2014, 23:20

... Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp 475 D D Ang, Stabilized aproximate solution of certain integral equations of first kind arizing in mixed problems of elasticity, ... contractive averaging, U.S Army Math Res ctr T S R 160 (1960) D D Ang, C D Khanh, and M Yamamoto, A Cauchy like problem in plane elasticity: a moment theoretic approach, Vietnam J Math 32 SI (2004) ... (6) In order to give a meaning to Eq (4), we must decide on a function space for f and g Physically f is a surface stress under the stamp, and therefore, we can allow it to have a singularity at...

Ngày tải lên: 06/08/2014, 05:20

... [4] Because the erythrocyte binding IgG quantitative analysis showed mild elevation in the patient, we concluded that the infant with HS was accompanied by ITP and DAT negative AIHA (Evans' syndrome) ... blood transfusion [12] Another report showed presence of both an anti-protein 4.2 antibody and other undefined autoantibodies against RBC associated with heavy transfusions in protein 4.2-negative ... discussion and editing of the manuscript; TO was principal investigator of erythrocyte binding IgG quantitative analysis; MK was principal investigator of platelet specific autoantibodies All authors...

Ngày tải lên: 10/08/2014, 22:20

... M, Watanabe I, Iwafuchi M, Sawada T: Hepatoblastoma producing both alpha-fetoprotein and human chorionic gonadotropin Clinicopathologic analysis of four cases and a review of the literature Cancer ... patient data and was a major contributor to the writing of the manuscript IS and FAM collected the clinical data FA obtained and interpreted radiological studies UA and IS reviewed the literature ... L, Pathak IC, Dash RJ, Joshi VV: Clinical, hormonal and ultrastructure studies of a virilizing hepatoblastoma Acta Paediatr Scand 1978, 67(3):389-392 Nakagawara A, Ikeda K, Tsuneyoshi M, Daimaru...

Ngày tải lên: 10/08/2014, 23:20

... the management of the patient, and was a major contributor in writing the manuscript KM, MI and SS analyzed and interpreted our patient data TY analyzed cardiac enhanced multislice CT SI, YM and ... the cardiac enhanced magnetic resonance imaging (MRI), the calcified lesion contained very little parenchymatous tissue and revealed no enhancement (Figure 3) A cardiac catheterization was performed ... responsible for manuscript editing and advice on the literature review All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests...

Ngày tải lên: 10/08/2014, 23:21

... submucosa as a solitary or sessile lesion with an inflammatory basis They can occur throughout the intestinal tract but most frequently in the gastric antrum and small bowel [3] IFPs usually measure ... two and cm in diameter However, there are also giant IFPs with a size of up to 12.5 cm in diameter having been reported [4] IFP was first described by Vanek as a ‘gastric submucosal granuloma with ... eosinophilic infiltration’ in 1949 [5] Histologically, IFPs are characterized by vascular and fibroblast proliferation with an eosinophilic inflammatory response The underlying cause of IFP remains...

Ngày tải lên: 11/08/2014, 03:21

... submucosa as a solitary or sessile lesion with an inflammatory basis They can occur throughout the intestinal tract but most frequently in the gastric antrum and small bowel [3] IFPs usually measure ... two and cm in diameter However, there are also giant IFPs with a size of up to 12.5 cm in diameter having been reported [4] IFP was first described by Vanek as a ‘gastric submucosal granuloma with ... eosinophilic infiltration’ in 1949 [5] Histologically, IFPs are characterized by vascular and fibroblast proliferation with an eosinophilic inflammatory response The underlying cause of IFP remains...

Ngày tải lên: 11/08/2014, 07:20

... beaten copper appearance and Lückenschädel Meanwhile in the occipital area, where the cranium and brain are closely associated, high ICP produced a gross bone defect and dura with brain herniated ... coronal and lambdoid sutures and diffuse skull changes with honeycomb configuration and beaten copper appearance Figure Occipital lump: a unilateral mass in the left occipital area with pulsation ... intracranial hypertension Meanwhile in the occipital area, where the cranium and brain are closely associated, high ICP can result in a bone defect and dura associated with brain herniated through this...

Ngày tải lên: 11/08/2014, 12:20

... surgical resection to confirm the diagnosis and reduce the risk of infection or malignant transformation (bronchioloalveolar carcinoma) Bronchial atresia and CCAM usually involve the same lobe and, ... as lung abscesses, cavitary neoplasms or inflammatory masses, bullous diseases, bronchiectases and post-inflammatory pneumatoceles Clinical and histological correlations are essential in establishing ... coexisting BA and CCAM in different lobes in a single case and cannot give definitive information relevant to the pathogenetic models and theories However, these findings suggest new insights into...

Ngày tải lên: 11/08/2014, 12:20

... other hand, chest computed tomography (CT), abdominal ultrasound, brain and orbit magnetic resonance imaging (MRI) scans, as well as brain and orbit magnetic resonance angiography (MRA), were all ... includes abnormal meibomian gland secretion and atrophy, intracranial hypertension with optic disc oedema, ocular sicca, corneal opacities, keratitis, myopia and decreased dark adaptation The "probable/likely" ... revealed a superior arcuate scotoma in his left eye (Figure 2) A detailed clinical investigation of all systems, including cardiovascular and neurological assessment was unremarkable Total blood...

Ngày tải lên: 11/08/2014, 20:20

... Case presentation A 42-year-old man presented with acute onset of a vasculitic rash on his buttocks and feet, abdominal pain and arthralgia This had been preceded by an episode of sore throat ... 145/95 Figure and endocapillary proliferation Glomerulus demonstrating increased mesangial cellularity Glomerulus demonstrating increased mesangial cellularity and endocapillary proliferation Figure ... Immunostaining for IgA Immunostaining for IgA mmHg He was therefore prescribed azathioprine 100 mg and ramipril 1.25 mg daily and the prednisolone was increased again to 40 mg once daily Unfortunately...

Ngày tải lên: 11/08/2014, 21:22

... showed dilatation of the pulmonary arterioles and alveolar capillaries Many bronchial and pulmonary arterioles contained recanalized thrombi or emboli The main anatomic diagnoses were: single ventricle ... presentation, he complained of severe cyanosis, shortness of breath with minimal exertion, and chest pain An electrocardiogram indicated sinus tachycardia of 120 beats per minute The QRS axis was ... rest At 27 years of age, the patient reported an increase in dyspnea with minimal exertion He was diagnosed with thrombosis of the Blalock-Taussig anastomosis and was treated with heparin for weeks...

Ngày tải lên: 11/08/2014, 23:21

... (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software upgrades (replacing or enhancing existing assets), and network ... prohibited Managing and Practicing OD in an IT Environment 261 how to proceed with the validated data, and the action plan and goals they create can be compared against the funnel to ensure that the ... slips and turnover among the team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and...

Ngày tải lên: 24/10/2013, 08:20

... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... soluble produced protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP does affect the solubility,...

Ngày tải lên: 06/03/2014, 01:20

... References Australian Financial Markets Association 2008 Australian Financial Markets Report Beechey, M 2008 “Lowering the Anchor: How the Bank of England’s In ation-Targeting Policies Have Shaped In ation ... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... long-term in ation expectations, changes in fiveand ten-year in ation forward rates, and so in break-even in ation rates, are by implication driven by changes in inflation risk premia As such, our measure...

Ngày tải lên: 15/03/2014, 07:20

... and so has nothing direct to say about current instantaneous in ation.9 In ation swaps are now far more liquid than in ation-indexed bonds and may provide alternative data for use in estimating ... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... References AFMA (Australian Financial Markets Association) (2008), ‘2008 Australian Financial Markets Report’ Beechey M (2008), ‘Lowering the Anchor: How the Bank of England’s In ation-Targeting Policies...

Ngày tải lên: 22/03/2014, 20:20

... Computational Natural Language Learning Conference, pages 25–32, Edmonton, Canada, May-June Association for Computational Linguistics James G Shanahan, Yan Qu, and Janyce Wiebe 2005 Computing Attitude ... in the automatically generated training data We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance for our maxent model, and constructed a dictionary of hedge ... Cohen, and Wlodzislaw Duch 2007 A shared task involving multi-label classification of clinical free text In Biological, translational, and clinical language processing, pages 97–104, Prague, Czech...

Ngày tải lên: 31/03/2014, 00:20

... Residual signal after applying speech modeling filter to noisy speech Time-domain waveforms of (a) : Noise signal, (b): Residual signal after STP analysis, and (c): Residual signal after LTP analysis ... generally has short duration would not affect an LTP result [7,8,10,11,13] Figure depicts residual signals after the STP analysis and the LTP analysis The input signal of the analysis contains ... analysis Table NCC between transient noise and residual signals Residual after STP analysis NCC Residual after LTP analysis 0.8267 0.9908 The NCCs between transient noise and residual signals after...

Ngày tải lên: 20/06/2014, 21:20

... can use bulk static dielectric constants es and ed for materials inside and outside the dot, respectively As a result, the standard Coulomb potential is modified due to appearance of polarization ... energy E have the origin at the X -point Equation for an undoped nanocrystal has been already solved earlier [26] In the following we shall employ, in fact, the solutions obtained in Ref [26] as the ... in Fig DFz ÀÞ as a function of the angles h and u on the spherical surface r = h for the former values of na The angles h and u are introduced in the standard form: ex = sinhcosu, ey = sinhsinu,...

Ngày tải lên: 22/06/2014, 18:20