... mm and in one case approached 2.0 mm The halo sign was either a unilateral or a bilateral finding in 12 and patients, respectively (Table 2) No Figure Parietal ramus of a normal temporal artery ... Follow-up CDS examinations Follow-up results obtained 14 ± days from baseline in those patients with negative CDS examination remained unremarkable Notably, halo signs disappeared in all 18 patients ... clinical examination, and routine laboratory examinations and chest X-ray, the inclusion criteria included at least one of the following: an ESR of 50 mm/ hour or more, new headache onset, jaw claudication,...
Ngày tải lên: 09/08/2014, 08:22
... histological examination, it consisted of laminated strands of a fibrinoid substance with a large amount of proteinaceous material in the peripheral white part (boiled albumin with a high collagen ... Kanazawa S, Narabavayashi I: A case of giant peritoneal loose body: usefulness of wide window width CT Nipon Igaku Hoshasen Gakkai Zasshi 2004, 64(4):223-224 Nomura H, Hata F, Yasoshima T, Kuwahara ... presentation in symptomatic patients is causing intestinal obstruction, as in this case If a patient presents with features of intestinal obstruction and X-ray films shows a calcified lesion in the...
Ngày tải lên: 10/08/2014, 23:21
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
... embedded in 1% agar, dehydrated using an ethanol series and embedded in Epon 812 Ultra-thin sections were doubly stained with uranyl acetate and lead nitrate and then examined with a JEM-1200 EX transmission ... total bacterial count in the untreated water dropped rapidly at first stage and slowly at second stage in the SC-CO2 treatment and the inactivation rate increased as the temperature increased ... al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in this...
Ngày tải lên: 05/09/2013, 09:38
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in...
Ngày tải lên: 06/03/2014, 01:20
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... References Australian Financial Markets Association 2008 Australian Financial Markets Report Beechey, M 2008 “Lowering the Anchor: How the Bank of England’s In ation-Targeting Policies Have Shaped In ation ... decompose into in ation expectations and in ation risk premia Due to a lack of data, we cannot this, and instead we estimate in ation forward rates as part of our model Vol No Estimating In ation ... value In an in ation-indexed bond, the coupons are indexed to in ation so that the real value of the coupons and principal is preserved In Australia, in ation-indexed bonds are indexed with a lag...
Ngày tải lên: 15/03/2014, 07:20
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... and so has nothing direct to say about current instantaneous in ation.9 In ation swaps are now far more liquid than in ation-indexed bonds and may provide alternative data for use in estimating ... high in ation in Australia Interestingly, there appears to have been a sustained general rise in inflation expectations between 2004 and 2008 at all horizons Again this was a time of rising domestic ... decompose into in ation expectations and in ation risk premia Due to a lack of data we cannot this and instead estimate in ation forward rates as part of our model 18 in ation, a low 2-year break-even...
Ngày tải lên: 22/03/2014, 20:20
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
... in the automatically generated training data We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance for our maxent model, and constructed a dictionary of hedge ... Computational Natural Language Learning Conference, pages 25–32, Edmonton, Canada, May-June Association for Computational Linguistics James G Shanahan, Yan Qu, and Janyce Wiebe 2005 Computing Attitude ... Cohen, and Wlodzislaw Duch 2007 A shared task involving multi-label classification of clinical free text In Biological, translational, and clinical language processing, pages 97–104, Prague, Czech...
Ngày tải lên: 31/03/2014, 00:20
Báo cáo toán học: " Transient noise reduction in speech signal with a modified long-term predictor" ppt
... Time-domain waveforms of (a) : Noise signal, (b): Residual signal after STP analysis, and (c): Residual signal after LTP analysis Table NCC between transient noise and residual signals Residual after ... contaminated by transient noise, pitch epoch that is located at farther from the current frame can be an alternative candidate of the current pitch In the proposed system, we set τmin and τmax ... unpredictable in general A relatively easy way to remove transient noise is to apply a time-domain median filter or a nonlinear power limiter to transient noise presence region [4-6,9] This article adopts...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " Research Article Application of the Subordination Principle to the Harmonic Mappings Convex in One Direction with Shear Construction Method" pot
... Inf Re ψ z n→∞ |z|
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Fine Splitting of Electron States in Silicon Nanocrystal with a Hydrogen-like Shallow Donor" ppt
... energy E have the origin at the X-point Equation for an undoped nanocrystal has been already solved earlier [26] In the following we shall employ, in fact, the solutions obtained in Ref [26] as the ... matrix elements Va ðhÞ in Eq 7, which reflect an asymmetry of the donor position inside the nanocrystal At the same time, one may neglect, apparently, the terms Vab ðhÞ and Vaa ðhÞ in Eq because ... the figure with solid line Since we direct the radial axis parallel to h, the donor is always situated somewhere at the right half of this axis ð within the range \ h/R \ We have calculated DFz...
Ngày tải lên: 22/06/2014, 18:20
Báo cáo toán học: " Stress Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp" potx
... Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp 475 D D Ang, Stabilized aproximate solution of certain integral equations of first kind arizing in mixed problems of elasticity, ... contractive averaging, U.S Army Math Res ctr T S R 160 (1960) D D Ang, C D Khanh, and M Yamamoto, A Cauchy like problem in plane elasticity: a moment theoretic approach, Vietnam J Math 32 SI (2004) ... (6) In order to give a meaning to Eq (4), we must decide on a function space for f and g Physically f is a surface stress under the stamp, and therefore, we can allow it to have a singularity at...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo y học: "Transient early preeclampsia in twin pregnancy with a triploid fetus: a case report" pot
... twin pregnancy with a successful outcome for the healthy co-twin after early transient preeclampsia Case presentation A 33-year-old Caucasian woman, gravida 3, para 1, was admitted to our clinic ... fetus and one complete or partial molar, with or without a triploid fetus, are rare The molar tissue can provoke early preeclampsia, heavy vaginal bleeding and persistent gestational trophoblastic ... pregnancy An enlarged placenta of 10 cm × 12 cm with some cysts was prominent on the anterior wall Blood flow had ceased in this placenta Urinary protein excretion was 2.5 g/L Maternal serum beta-humanchorionic-gonadotropin...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo sinh học: "Reconstructing phylogenies from noisy quartets in polynomial time with a high success probability" docx
... nected components, each with at most n leaves, and such a node can be found in linear time in T such that each of the trees in T - {v} has at most n leaves An internal node v of T having such a property ... property is called a separator of T Notice that a phylogeny T may have more than one separator, but our algorithms in Tables 1, 2, and need only one of them Given a phylogeny T and a separator v of ... theoretical analysis has been done In this paper, we propose a new model-based approach to measuring the accuracy of a quartet-based phylogeny reconstruction method, i.e., to analyze the probability...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo y học: " Mapping the potential distribution of high artemisinin-yielding Artemisia annua L. (Qinghao) in China with a geographic information system" ppsx
... March; ATAP: average temperature in April; ATMA: average temperature in May; ATJ: average temperature in June; ATJU: average temperature in July; ATA: average temperature in August; AAT: average ... Kumar S, Khanuja SPS, Kumar TRS, Jain DC, Srivastava S, Bhattacharya AK, Saikia D, Shasany AK, Darokar MP, Sharma RP: Method for the use of alpha arteether as an anti-bacterial and anti-fungal agent ... in January (°C) ATJA Average temperature in February (°C) ATF Average temperature in March (°C) ATM Average temperature in April (°C) ATAP Average temperature in May (°C) ATMA Average temperature...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo y học: "In silico experimentation with a model of hepatic mitochondrial folate metabolism" pps
... with variation in dietary input and vitamin status We plan to investigate the dynamic properties and potential interactions among the many methyltransferases that act in parallel using SAM as a substrate ... groups are carried by an increase in the rate of the GNMT reaction during loading The rise in SAM also causes an increase in the rate of the CBS reaction during loading, so there is an increased ... compartments In addition, AICAR is a variable in the model that couples the PGT and AICART reactions Finally, we have added a serine sink that corresponds to the use of cytosolic serine in gluconeogenesis...
Ngày tải lên: 13/08/2014, 16:21
One Night with a Prince
... more adulterous affairs he engaged in, the more cynical he became about marriage, his brothers’ happy unions notwithstanding Any woman worth her salt married for financial or social advantage ... been with Christabel from the beginning of her marriage, first as a maid-of-all-work, then as a lady’s maid Since they were nearly the same age, Christabel regarded her less as a servant than a ... instantly in Gavin’s mind, of a small, raven-haired lass with a very large gun “I rode out to speak to her husband at his estate about his mounting debt at the Blue Swan, and she put a hole in my cabriolet—not...
Ngày tải lên: 25/05/2015, 17:20
PHOTOSTIMULATED QUANTUM EFFECTS IN QUANTUM WELLS WITH a PARABOLIC POTENTIAL
... expressions for electric field → − intensity vector E along the coordinate axes for the case of a specific GaAs/GaAsAl quantum wells The parameters used in the calculations are as follows [7, 8]: = 12,5; ... CONCLUSION In this paper, we have studied the photostimulated effects in quantum wells with a parabolic potential When a two dimensional completly degenerate electron gas system is placed in an EMW and ... the laser radiation; and on the parameters QW with a parabolic potential When ω0 → 0, the Eqs (9), (10), (11) give the same results as those obtained in bulk semiconductor [5, 12] The analytical...
Ngày tải lên: 31/10/2015, 10:42
Bayesian recursive algorithms for estimating free space and user intentions in a semi autonomous wheelchair with a stereoscopic camera system
... This approach is based on the least-median-of-squares estimator (Ahmed and Farag 2005) In general, the problem of calibrating camera parameters has encouraged several researchers to advance various ... Motivation There are an increasing number of people suffering from disability arising from several causes including accidents and diseases, including spina bifida and Friedreich’s Ataxia Reports ... chapter also discusses about head commands obtained from a head-movement sensor, a BR algorithm for estimating freespace and an advanced BR algorithm for estimating dynamic freespace and user intention...
Ngày tải lên: 20/05/2016, 15:28
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... greater access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager ... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt...
Ngày tải lên: 12/09/2012, 15:05