A novel multiplex suspension array for rapid subgenogrouping of enterovirus 71 (EV71) strains from the 2008 epidemic of hand

... the operation for this inverter have proved its feasibility for dc-ac conversion in wind turbine applications ACKNOWLEDGMENT The authors wish to thank Natural Sciences and Engineering Research Council ... possibility for a low cost and high efficiency dc-ac converter appropriate for small wind turbine applications The inverter has a low component count with only power...

Ngày tải lên: 03/01/2014, 19:16

... T thermophilus E coli A pernix 277 277 283 TSIPGVYACGDIVTYPGKLPLIVLGFGEAAIAANHAAAYAN-PALKVNPGHSSEKAAPGT TSIPGVFAAGDVMDHI YRQAITSAGTGCMAALDAERYLD GLADAK TSIPGIFAAGDCTSMWPGFRQVVTAAAMGAVAAYSAYTYLQEKGLYKPKPLTGLK ... (Osaka, Japan) Emulgen 911 was a gift from Kao Chemical (Tokyo, Japan) NADPH, NADH and NADP+ were purchased from Oriental Yeast (Tokyo, Japan) a- Cyano-4-hydroxycinnamic ac...

Ngày tải lên: 18/02/2014, 08:20

... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAG AGCTGATCTTCGAAGATCTTCGAAGAT Biotin-TCGACTTCAAGCTTGTACAAGCTTGTAG AGCTGAAGTTCGAACATGTTCGAACATC Biotin-AACGACGGTCGCTCCGCCTGGCT nM Unlabeled HSE DNA-binding activity ... confirm that the assay specifically measures HSF1 DNA-binding activity Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombi...

Ngày tải lên: 18/02/2014, 14:20

... user input without WBMs, xt be the best word spacing state for ot where ≤ t ≤ n Assume that xt is either (space after ot ) or (no space after ot ) Then each best word spacing state xt for all t ... Nakagawa 2004 Chinese and Japanese word segmentation using word- level and character-level information In COLING ’04, page 466, Morristown, NJ, USA Association for Computational Ling...

Ngày tải lên: 17/03/2014, 02:20

... Asia and southern China have high frequencies of a-thalassemia caused by a-globin gene mutations and deletions This study was designed to find an efficient and simple diagnostic test for the mutations ... carrier couples and for prenatal diagnosis of conception by couples who are both carriers of this type of gene deletion Diagnostic assays of the a-thalassemia...

Ngày tải lên: 23/03/2014, 22:20

... al.: A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases Journal of Translational Medicine 2011 ... substantially from 0.66 for PSA alone to 0.91 for A +PSA Figure shows the ROC curves comparing the diagnostic power between PSA alone and the combined A...

Ngày tải lên: 18/06/2014, 19:20

... earlier [6] Single -step Dengue multiplex RT-PCR (M -RT-PCR) A one- step single tube serotype-specific multiplex PCR was performed with RNA from standard dengue viruses and confirmed dengue virus-infected ... standardized a one step single tube protocol for rapid serotyping of dengue viruses This assay can be performed rapidly with in a period of hour...

Ngày tải lên: 20/06/2014, 01:20

... seroMAPbased approach over ELISA The multiplex A+ PSA assay quantifies autoAb and total PSA in one reaction To develop a multiplex assay that measures total PSA and autoAb in a single reaction, ... as free PSA and proPSA [22], new cancer biomarkers such as PCA3 [23], as well as combinatory assays measuring PSA and other parameters such as AMACR [24,25] In this study,...

Ngày tải lên: 20/06/2014, 03:20

... uniform and non-uniform arrangements In ref [20], different types of array structures for smart antennas (ULA, UCA and Uniform Rectangular Array (URA)), AOA estimation and beamforming performance ... sub-arrays affects the performance of this array Therefore, the PA is an appropriate and simple geometry for AOA estimation and can modify the performance of the conventional ULA in AO...

Ngày tải lên: 21/06/2014, 01:20

... under microwaves irradiation Appl Catal, A 2009, 371(1-2):22-30 Subrahmanyam KS, Panchakarla LS, Govindaraj A, Rao CNR: Simple Method of Preparing Graphene Flakes by an Arc-Discharge Method J Phys ... both methods are used to analyze the Raman data The ID/IG ratio obtained using both peak height and integrated intensity methods are plotted in Figure 7a for the six samples A statis...

Ngày tải lên: 21/06/2014, 06:20

... or capturing the same scene at approximately the same camera orientation A security goal of each node in a cluster is to send partial visual information, which we call shares to a base station ... practicality Finally, we note that our paradigm is geared towards visual data, or any kind of data whose semantics are not destroyed by small perturbations The inherent redundant nature...

Ngày tải lên: 22/06/2014, 23:20

... Residential area TV TV TV PC Residential area n Figure 1: A larger-scale VOD system supported by parallel video servers video- data streams during a short time interval It wastes the server bandwidth and ... the Medusa scheme is approximately 280 Mbits/s At the same request-arrival rate, the average bandwidth consumption of the FCFS batching is Medusa: A Novel Stream-Schedul...

Ngày tải lên: 23/06/2014, 01:20

... screening A value of above 3.0 is regarded as satisfactory for screening (for example in plant breeding) , values of and upward are suitable for quality control analysis, and values of above are ... composition of lignin, shrinkage or the extent of longitudinal growth stress This paper evaluates the potential of NIRS for the assessment of some major chemic...

Ngày tải lên: 08/08/2014, 14:20

... assays ("bead arrays") Cytometry Part A 2006, 6 9A: 384-390 Hanley B: Variance in multiplex suspension array assays: carryover of microspheres between sample wells Journal of Negative Results in ... important However, intraplexing assays [3] can address the issue of counts per classifier variance and precision allowing multiplexed assays to work with relatively low values of...

Ngày tải lên: 13/08/2014, 16:21

... evolutional rate of EV71, new subgenogroups have been constantly identified The subgenogroup B3 strain was the main causative agent in the epidemics of Sarawak and Peninsular Malaysia in 1997 (Cardosa, ... sequenced a fragment of 207-bp length of the VP4 region from 23 Taiwanese EV 71 isolates and together with another 21 strains from GenBank, they separated the 44...

Ngày tải lên: 16/10/2015, 15:39