Investigating the molecular mechanism of ERp29 regulated cell cycle arrest in breast cancer

... measure the mobility of the components in the PGCs The medaka embryo was peeled off the chorion, and the segment containing the part of PGCs was excised for observation by microscopy and FCS ... dynamic nature of the nuage Schematic diagram of the preparation of PGCs of medaka specimen (A) OlvasGFP was expressed in the medaka PGC at stage 24 and...

Ngày tải lên: 18/02/2014, 16:20

... probe the molecular determinants of the activity and specificity of the enzyme We have clearly shown that the substrate specificity of AtdA can indeed be controlled by the AtdA3 subunit The V205A ... 4.5 A of the substrate, forming the substrate- binding pocket, were selected for saturation mutagenesis studies Saturation mutagenesis of the subs...

Ngày tải lên: 19/02/2014, 02:20

... with the sequences of 1CEV and 1RLA and pasted into the structural alignment The alignment was then corrected by hand Since the sequences of the two arginases and agmatinase greately differ in the ... that the environment of tryptophan residues is essentially conserved in the mutant enzyme On the other hand, the absence of major differences in the CD...

Ngày tải lên: 21/02/2014, 01:21

... b-strands instead of eight, with the C and D strands and the intervening loop forming a large loop, exposing some hydrophobic residues in this region that are normally buried on the inside of the ... the protein [98] Dislocation of the C and D strands from their native edge region may result in the formation of a new interface involving A and B strands which...

Ngày tải lên: 07/03/2014, 10:20

... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... gene, KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal...

Ngày tải lên: 18/06/2014, 19:20

... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... gene, KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal...

Ngày tải lên: 20/06/2014, 03:20

... spontaneously produced in organ cultures of synovial tissues derived from RA patients Addition of anti-inflammatory cytokines IL-4 and IL-13 completely inhibited the production of IL-17 in synovial ... by activated T cells was completely inhibited by adding OPG 284 Using an ELISA system, we measured the level of a soluble form of RANKL in the synovial fluids Concentrations of...

Ngày tải lên: 09/08/2014, 06:22

... reaction to radiation following mantle-field irradiation Comparison of follow-up by conventional x-ray and by computed tomography] Radiologe 1988, 28:20-28 Page of 17 Lind P: Clinical relevance of pulmonary ... Pater J: Interpreting the significance of changes in health-related quality -of- life scores J Clin Oncol 1998, 16:139-144 23 Velikova G, Stark D, Selby P: Quality of...

Ngày tải lên: 09/08/2014, 09:20

... being there for me You inspire and motivate me every day of my life Thank you 
 iv
 ABSTRACT Brandy Lee Akin INVESTIGATING THE MOLECULAR MECHANISM OF PHOSPHOLAMBAN REGULATION OF THE Ca2+-PUMP OF CARDIAC ... back into the lumen of the SR by the Ca2+ pump, SERCA2a, making Ca2+ available for the next contraction (1) Therefore, the rate of Ca2+ transport by S...

Ngày tải lên: 24/08/2014, 11:06

... Disclaimer Title of Thesis/Dissertation: The Molecular Mechanism of Break Induced Replication For the degree of Master of Science Choose your degree I certify that in the preparation of this thesis, I ... The Molecular Mechanism of   Break Induced Replication  Major  Professor:  Anna  Malkova     DNA  double  strand break  (DSB)  is  one of the  most  thre...

Ngày tải lên: 24/08/2014, 13:24

... : The comparison of the model with the predictor of the Karakiewicz nomogram only with the one with predicators of both the Kattan nomogram and the Karakiewicz nomogram b : The comparison of the ... treatment THERAPY The treatment of renal cell carcinoma depends on the final pathologic and radiologic staging of the patient Essentially, in the lo...

Ngày tải lên: 11/09/2015, 09:56

... Molecular Basis of Siah2 Substrate Specificity Given the different roles of Siah1 and Siah2 in cancer and their different cellular functions, it is important to understand the structural basis ... Furthermore, it was found that the amounts of PHD3 bound to full length Siah2 and the SBD of Siah2 were similar The comparable binding of PHD3 to full l...

Ngày tải lên: 23/09/2015, 14:47

... objectives of the study are to: Validate breast cancer cells as a model to study the dual inhibition of mTOR and telomerase Investigate rapamycin s inhibition of the mTOR pathway and telomerase in breast ... test the efficacy of mTOR kinase domain inhibitors in preclinical and clinical studies (Menon and Manning 2008) These will be discussed in det...

Ngày tải lên: 05/10/2015, 13:53

... molecular mechanisms of TbCentrin2 and TbCentrin4 in Trypanosoma brucei viii Centrins are EF-hand containing proteins that bind Ca2+ They are regulatory proteins functioning through specific binding ... database screening for T brucei proteins containing centrin binding motif initially characterized in Sfi1p have been used Centrins are proteins functioning through interactio...

Ngày tải lên: 12/10/2015, 17:35

... nodes behind the breastbone Or Inflammatory breast cancer is a rare type of breast cancer The breast looks red and swollen because cancer cells block the lymph vessels in the skin of the breast ... dissertation, the author attempt to investigate how ERp29 may regulate another effector of PERK, Nrf2 in breast cancer cell lines The levels of eIFα...

Ngày tải lên: 12/10/2015, 17:35