g1 s cell cycle arrest in htlv 1 infected t cell lines

Báo cáo y học: "Mechanisms employed by retroviruses to exploit host factors for translational control of a complicated proteome" pot

Báo cáo y học: "Mechanisms employed by retroviruses to exploit host factors for translational control of a complicated proteome" pot

... donors This decrease also was observed in the supernatant of CD4+ and CD14+ cells isolated from HIV1 seropositive patients [16 8] Taken together, these results indicate that HIV -1 targets both the ... protein synthesis [12 ] The finding that unspliced RSV transcript can be a substrate for both translation and packaging into virions indicated that these processes are not mutually exclusive in this ... documented by Bennasser et al [17 8], but remains controversial [17 9] Tat RSS activity is modest and not global, and is demonstrated in several [17 6 ,17 8] but not all assays [17 9] Tat RSS activity is...

Ngày tải lên: 13/08/2014, 05:21

20 365 0
Tài liệu Báo cáo khoa học: "Abstraction and Generalisation in Semantic Role Labels: PropBank, VerbNet or both?" doc

Tài liệu Báo cáo khoa học: "Abstraction and Generalisation in Semantic Role Labels: PropBank, VerbNet or both?" doc

... confounding factor in this analysis, we expressly limit our investigation to data analyses and statistical measures that not exploit syntactic properties or parsing techniques The conclusions reached ... equivalence classes in certain contexts While both role inventories under scrutiny here use atomic labels, their joint distribution shows interesting relations The proportion counts are shown in Table ... Several of the findings in the previous sections shed light on the generality of the semantic roles in the two inventories Results in Section show that previous results can be reinterpreted as...

Ngày tải lên: 20/02/2014, 07:20

9 558 0
Tài liệu Báo cáo khoa học: "A High-Accurate Chinese-English NE Backward Translation System Combining Both Lexical Information and Web Statistics" pdf

Tài liệu Báo cáo khoa học: "A High-Accurate Chinese-English NE Backward Translation System Combining Both Lexical Information and Web Statistics" pdf

... bias in estimating statistical scores Table compares the result of different feature combinations It considers only foreign NEs in the test data From the result we could conclude that both statistical ... less similar to the estimation of phonetic similarity, we not use an intermediate representation of meanings to estimate word sense similarity We treat the English translations in the C-E bilingual ... returned snippets, combining both linguistic and statistical information to find the correct translation Our system can be split into three steps: candidate retrieving, candidate evaluating, and...

Ngày tải lên: 20/02/2014, 12:20

8 569 0
Báo cáo khoa học: "An Exploration of Forest-to-String Translation: Does Translation Help or Hurt Parsing?" ppt

Báo cáo khoa học: "An Exploration of Forest-to-String Translation: Does Translation Help or Hurt Parsing?" ppt

... according to labeled-bracket F1 This suggests that the reason the forest-to-string system is able to generate better translations is that it can soften the constraints imposed by the syntax of the ... parses that are better on average NIST 2003 Table 1: Data used for training and testing the parsing and translation models System Charniak tree-to-string forest-to-string forest-to-string Objective ... tree-to-string translation, but is free to select any of the trees contained in the parse forest eeee target string decoder eeee target string Translation hurts parsing Figure 1: (a) In tree-to-string...

Ngày tải lên: 30/03/2014, 17:20

5 299 0
Sudden Death in Patients with Myocardial Infarction and Left Ventricular Dysfunction, Heart Failure, or Both pdf

Sudden Death in Patients with Myocardial Infarction and Left Ventricular Dysfunction, Heart Failure, or Both pdf

... known as rapamycin) A single study involving 46 patients has suggested that sirolimus has the potential to reverse angiographic disease in some patients with established disease.5 Most postoperative ... considering earlyintervention strategies, including short-term therapies, in selected patients at risk This is supported by the fact that the majority of our patients (74 percent) who were resuscitated ... repertoires of downstream gene activation LXRβ is ubiquitously expressed, whereas LXRα is expressed predominantly in tissues involved in lipid homeostasis in the liver, intestine, adipose tissue,...

Ngày tải lên: 27/06/2014, 00:20

18 362 0
Báo cáo y học: "Asthma: Eosinophil Disease, Mast Cell Disease, or Both" potx

Báo cáo y học: "Asthma: Eosinophil Disease, Mast Cell Disease, or Both" potx

... asthma and eosinophilic bronchitis is present within the ASM bundles In asthmatic subjects, there are numerous mast cells within the ASM, but these are rarely seen in the ASM of patients with ... underlying abnormality in the behaviour of asthmatic ASM Targeting this mast cell ASM interaction in asthma offers exciting prospects for the treatment of this common disease References Holgate ST, ... similar findings.27 These observations indicate that although eosinophils are often present across the spectrum of asthma severity, about 25% of patients have active disease in their absence, so they...

Ngày tải lên: 08/08/2014, 21:20

7 410 0
Báo cáo y học: "Acute lung injury, overhydration or both" doc

Báo cáo y học: "Acute lung injury, overhydration or both" doc

... monitoring Competing interests The author (s) declare that they have no competing interests References Martin GS, Eaton S, Mealer M, Moss M: Extravascular lung water in patients with severe sepsis: ... predicts survival in patients with septic shock A retrospective pilot study Chest 2000, 11 7 :17 49 -17 54 11 Sakka SG, Klein M, Reinhart K, Meier-Hellman A: Prognostic value of extravascular lung water ... positive fluid balances and high EVLWs may denote an adverse prognosis, in critically ill septic patients [10 ,11 ] It is noteworthy that in Martin and colleagues’ study [1] a high EVLW was not...

Ngày tải lên: 12/08/2014, 20:21

2 219 0
bai tap neither...nor, either...or,both...and

bai tap neither...nor, either...or,both...and

... know the time because _ of us had a watch IV Choose the correct statement to AGREE with the first sentence The students weren t able to finish the test quickly A I was either B Neither was I ... Neither – Both – Not only … But also 10 11 12 13 14 15 16 17 A or B also C nor D and It is the event a lot A has been talked about B that has been talked about C Has talked about D that has talked ... talked about She hard but also gets on well with her classmates A doesn t only study B studies not only C not only studies D not studies only Either you leave now ! A I will also call the police...

Ngày tải lên: 07/06/2015, 03:00

8 8K 57
Team composition  conditional cooperation  temporary agents permanent agents or both

Team composition conditional cooperation temporary agents permanent agents or both

... both agents have incentives to provide high effort This is due to the fact that investments are wasted if the team separates 6 .1 Optimal team composition The last step is to consider whether the ... will stay the same Thus, maybe the opposite of what intuitively was expected: most of the benefits from investing go to the investor Our next step is to consider when agents are going to invest ... in the strategies of both players In fact, there are no strategic considerations possible, because after this simultaneous investment decision there are no investment decisions left Besides that,...

Ngày tải lên: 30/09/2015, 06:41

43 333 0
Báo cáo khoa học: "Splitting Long or Ill-formed Input for Robust Spoken-language Translation" docx

Báo cáo khoa học: "Splitting Long or Ill-formed Input for Robust Spoken-language Translation" docx

... is selected by computing the total sum of all the possible combinations of the partial semantic distance values The structure with the smallest total distance is chosen as the best structure The ... a substring and the passive arc satisfies the leftmost part of an uninstantiated variable in the pattern of active arcs for the left-neighboring substring, the variable is instantiated with the ... possible structures (Furuse, 19 96) The best structure is determined when a relative passive arc is created Only the best substructure is retained and combined with other arcs The best structure...

Ngày tải lên: 08/03/2014, 05:21

7 359 0
Báo cáo khoa học: "Automatic Evaluation of Chinese Translation Output: Word-Level or Character-Level" doc

Báo cáo khoa học: "Automatic Evaluation of Chinese Translation Output: Word-Level or Character-Level" doc

... constraint The NIST'08 English-to-Chinese translation task evaluated 12 7 documents with 1, 830 segments Each segment has reference translations and the system translations of 11 MT systems, released ... domain The IWSLT'08 English-to-Chinese ASR challenge task evaluated the translation quality of machine translation systems (Paul, 2008) The test set contained 300 segments with human assessment ... metrics is very small However, it still shows that character-level metrics perform no worse than word-level metrics For the NIST’08 EC task, the system translations of the 11 submitted MT systems...

Ngày tải lên: 17/03/2014, 00:20

6 344 1
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx

Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx

... HXB2-Met(e) Virus replication was compromised though in SupT1 cells since tRNAMet(i) was still selected as the primer The fact that HXB2-Met(i)AG replicated in SupT1 cells is consistent with our results ... Met(i) 5' gtttccctttcgctttcagaaccatcctctgctaccactgctagagattttcc 3' 5' ggaaaatctctagcagtggtagcagagggtggttctgaaagcgaaagggaaac 3' Met(i) AG http://www.retrovirology.com/content/4 /1/ 10 5' gtttccctttcgctttcagaaccaccctctgctaccactgctagagattttcc ... tRNAMet(i )in cells is limiting relative to tRNAMet(e) To address this issue, we compared the amounts of tRNAMet(i) with tRNAMet(e) and tRNALys,3 found in SupT1 cells We first established that our...

Ngày tải lên: 13/08/2014, 09:20

14 189 0
EXERCISES ON “BOTH ... AND, EITHER .. OR, NOT ONLY ... BUT ALSO,  NEITHER ... NOR”

EXERCISES ON “BOTH ... AND, EITHER .. OR, NOT ONLY ... BUT ALSO, NEITHER ... NOR”

... She did not design it to be attractive.(neither nor) 90 Arthur is absent this evening Ricardo is absent this evening, too (both and) 91 The leopard faces extinction The tiger also faces extinction ... how to ice-skate (neither nor) If I read a book, it must be interesting If I read a book, it must be short (either or) Jack isn t kind Jack isn t patient (neither nor) I would like to eat Pizza ... didn t have to go to school last Sunday He didn t have to go to school last Sunday (neither nor) That boy was dirty, and he was lazy, too (not only but also) Dick doesn t need a bike He doesn’t...

Ngày tải lên: 18/05/2015, 12:00

4 5,4K 65
Bai tap ve Either...or,neither...nor,both...and,not only.....but also

Bai tap ve Either...or,neither...nor,both...and,not only.....but also

... didn t have to go to school last Sunday He didn t have to go to school last Sunday => Neither ……………………………………………………………………… Mary hasn t studied Spanish Her friend hasn t studied Spanish => Neither ... ……………………………………………………………………… 10 They didn t like music They didn t like sports => They like ……………………………………………………………………… 11 He isn t a doctor I’m not a doctor => Neither …………………………………………………………………….… 12 I can t speak ... ……………………………………………………………… Dick doesn t need a bike He doesn t like to go on foot => Dick doesn t either …………………………………………………………… They won t come here tomorrow They won t stay at home => They won t either ……………………………………………………………...

Ngày tải lên: 27/06/2015, 04:00

2 12K 167
Tổng quan về NAT (Network Address Translation)

Tổng quan về NAT (Network Address Translation)

... local t bảng NAT Nếu NAT không t m thấy hàng nào, t o hàng bảng NAT thực bước th t NAT table mappings: Private IP Translated IP Original Port Translated Port 19 2 16 8 10 10 25 2000 19 2 16 8 10 10 26 ... điểm t y ý có trường hợp : + Host bên entry bảng NAT nhận thông tin “host unreachable” có entry NAT-IPs + Bi t IP k t nối có k t nối t host bên mạng Tuy nhiên NAT-IPs IP th t host Và thông tin ... client b t đầu kênh truyền control trừ FTP session rỗi sau thời gian timeout Xin nói thêm giao thức FTP có chế passive non-passive Giao thức FTP dùng port (control data) Với chế passive (thụ...

Ngày tải lên: 15/08/2012, 10:40

15 2,6K 51
When the Discussion Gets Stalled or Heated

When the Discussion Gets Stalled or Heated

... Maintain even disposition Ask clarification questions Delay with process not contention Seek advancement on less contentious issues and return to  others later Reposition or frame in positive, mutual­gain terms ... faces extreme difficulties in the implementation phase  Slow­Fast Approach • Negotiations are conducted slowly to ensure that the final  agreement is responsive to major constituents providing  greater speed in implementation  Slow­Slow Approach ...  Switching sides on an issue to create confusion  Suggesting you will provide something of value you don t intend to deliver  Offering false flattery  Intimidating other side with false claims...

Ngày tải lên: 22/08/2012, 22:07

15 622 0
Quagmire or Gold Mine?

Quagmire or Gold Mine?

... Williams, Ed., Bots and Other Internet Beasties SAMS.NET, 19 96 http://bf.cstar.ac.com.bf/ Lewis, D and Gale, W Training text classifiers by uncertainty sampling In Proceedings of the Seventeenth ... filter MetaCrawler s output Since Ahoy! s filtering algorithm is heuristic, it asks its users to label its answers as correct or incorrect Ahoy! relies on its initial power to draw numerous users ... descriptions learns to extract product attributes such as price Shopbot learns by querying the store for information on popular products, and analyzing the store s responses In the software shopping...

Ngày tải lên: 31/08/2012, 16:47

4 526 1
Cambridge.University.Press.The.Works.of.Archimedes.Volume.1.The.Two.Books.On.the.Sphere.and.the.Cylinder.Translation.and.Commentary.May.2004.pdf

Cambridge.University.Press.The.Works.of.Archimedes.Volume.1.The.Two.Books.On.the.Sphere.and.the.Cylinder.Translation.and.Commentary.May.2004.pdf

... different sets of lines. ) The way to understand the point of the postulates, is, I suggest, the following: There are many possible clusters of lines, such that: all the lines in the cluster share the ... asserted, as a stratagem made to attract false proofs Thus, for instance, the last theorem implies the falsity of the following statement: the greatest segment of the sphere is obtained with the ... “all” into the text, translating as if it had “among all lines having the same limits ” The situation is in fact somewhat confusing To begin with, there is no unique set of lines having the same...

Ngày tải lên: 21/09/2012, 11:00

387 1,2K 3
Ship or Sheep Third Edition

Ship or Sheep Third Edition

... a student working alone,but can be usedfor classroom teachingaswell Seethe symbolsin the students'introduction,especially t DiagnosticTests Youcan usetheseif you needto assess students' difftculties ... few times First practise putting your energy into the strongly stressedwords Next practise saying the weakly stressed words with less energy, so that you say them more quietly Then practise saying ... words and then in sentences without beingdistracted the by written word - for extra practice of soundsthey find difficult tx DTAGNOSTIC TESTS All students should Test A Test B requires the help...

Ngày tải lên: 03/10/2012, 15:20

237 1,3K 33
w