... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...
Ngày tải lên: 15/02/2014, 01:20
... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx
... has already established Of two possible dimeric structures of LPL, the head-tohead and the head-to-tail models, the studies of the chimeric proteins of hepatic lipase and LPL and the tandem repeat ... (Fig 4A and B, 5) The lipase activity of the K413A mutant is similar to that of wild type LPL, whereas the esterase activity is reduced to 60% of t...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx
... loop, the first and last turns of helices E and F, and the C-terminus helices I and J In addition, there is a lysine-rich N- and C-terminus, in accordance with the basic isoelectric point of CagS ... as that of other members of this family Finally, when crystallized in the presence of Cu(II), the protein shows the presence of the ion coordinated in a...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx
... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efficient in the stimulation of cAMP productio...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... characterization of the human VGSC b1B subunit The human b1B subunit is a novel splicing variant of the b1 subunit via alternative intron retention The retained intron encodes a novel extracellular, ... peptide Functional expression of the human b1B subunit with NaV1.2 in Xenopus oocytes To explore the regulatory function of the hum...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... Sampieri, F & Granier, C (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the a- and b-sites of the mammalian s...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps
... study we have investigated the role of CCR7 in the recruitment of CD4+ memory T cells into the inflamed joints of patients with JIA, and attempted the functional and anatomical dissection of these ... degree of disease activity and treatment at the moment of sampling Expression of CCL21 in SF and synovial tissue To gain further insight into t...
Ngày tải lên: 09/08/2014, 06:22
báo cáo khoa học: " Molecular and functional analyses of COPT/Ctrtype copper transporter-like gene family in rice" pdf
... heteromeric interactions of COPTs AIg5, a transmembrane protein with C terminal in the cytoplasm; NubI, N-terminal half of ubiquitin protein; NubG, mutated N-terminal half of ubiquitin protein; Cub, ... COPT3 and COPT7 in shoot, and slightly suppressed COPT2 and COPT4 in root Zn deficiency induced COPT1, COPT5, and COPT7 and slightly suppressed COPT4 in root and indu...
Ngày tải lên: 11/08/2014, 11:22
functional characterisation of phosphodiesterase 4d7 in prostate cancer
... and binds phosphatidic acid (PA) via a TAPAS domain in its unique N-terminal region An increase in intracellular CA2+ brings about binding of PDE4A1 to PA and insertion into lipid bilayers in an ... domain REC domains play a crucial role in bacterial signalling systems They may also be involved in protein-protein interactions (Galperin 2010) Phosphorylation of the REC domain may...
Ngày tải lên: 22/12/2014, 21:15
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS
... secretion and therefore the salt tolerance mechanism in the mangrove Avicennia officinalis These results validate the previous findings that aquaporins play a critical role in salt secretion and water ... physiological and molecular aspects of salt tolerance in A officinalis The notable contributions of this study include confirmation of the r...
Ngày tải lên: 09/09/2015, 08:13
The role of hydrogen sulphide in the cardiovascular system emphasis on haemorrhagic shock
... desensitization in isolated haemorrhagic- shocked rat mesenteric artery The authors showed that agonists of protein kinase C and antagonists of protein kinase G could inhibit the Introduction reduction in ... (IRFI-042) to haemorrhagic- shocked rats could inhibit the increase in NFκB binding activity, which in turn inhibited the rise in TNF-α concentration In the l...
Ngày tải lên: 13/09/2015, 21:24
MOLECULAR AND FUNCTIONAL CHARACTERISATION OF THE ROLE OF HYDROGEN SULPHIDE IN SEXUAL MEDICINE
... muscles of the helicine arteries are relaxed, blood inflow to the lacunar spaces increases Relaxation of the smooth muscle of the trabeculae then dilates the lacunae, allowing for the expansion of the ... tissue against the tunica albuginea which in the process, compresses the subtunical venules against the tunica (the stretching of the tunica also compres...
Ngày tải lên: 12/10/2015, 17:33