MOLECULAR AND FUNCTIONAL CHARACTERISATION OF THE ROLE OF HYDROGEN SULPHIDE IN SEXUAL MEDICINE

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the ﬁndings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the helicases of the phage-encoded superfamily III proteins The ... strand and the b9 strand to the b10 strand at the bottom of the Zn-stem loop in the pRN1 prim–pol structure However, because the Zn-stem loop is a fairly self-standing structure protruding from...

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett 385, 21 4 22 0 Coombs, G.H (1986) Intermediary ... (19 92) Molecular characterization of cDNA encoding for adenylate kinase of rice (Oryza sativa L.) Plant J 2, 845–854 20 Brune, M., Schumann, R & Wittinghofer, F (1985) Cloning and sequencing of...

Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx

... has already established Of two possible dimeric structures of LPL, the head-tohead and the head-to-tail models, the studies of the chimeric proteins of hepatic lipase and LPL and the tandem repeat ... (Fig 4A and B, 5) The lipase activity of the K413A mutant is similar to that of wild type LPL, whereas the esterase activity is reduced to 60% of the wild type and the model structure displays no ... orientation, the catalytic site in the N-terminal domain of one subunit and the substrate recognition site in the C-terminal domain of the other face each other, thereby bringing together the substrate-binding...

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... loop, the ﬁrst and last turns of helices E and F, and the C-terminus helices I and J In addition, there is a lysine-rich N- and C-terminus, in accordance with the basic isoelectric point of CagS ... as that of other members of this family Finally, when crystallized in the presence of Cu(II), the protein shows the presence of the ion coordinated in a small cavity of the surface at the polar ... strand of a second monomer, allowing for the formation of the dimer The surface of interaction between monomers also involves portion of chains D and E of the two monomers, which are held together...

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efﬁcient in the stimulation of cAMP production, CRFR1c and CRFR1b have ... independent of cAMP and IP3 [11,12,33] Neither CRFR1f, g or h isoforms were able to stimulate any of the cis-elements Instead the reporter gene expression decreased when these isoforms were cotransfected...

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identiﬁed and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...

Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

... characterization of the human VGSC b1B subunit The human b1B subunit is a novel splicing variant of the b1 subunit via alternative intron retention The retained intron encodes a novel extracellular, ... peptide Functional expression of the human b1B subunit with NaV1.2 in Xenopus oocytes To explore the regulatory function of the human b1B subunit, we injected cRNA of human b1B, as well as cRNA of the ... 2003 Cloning and characterization of Na+ channel b1B (Eur J Biochem 270) 4763 reaction (RT-PCR) and RACE-PCR Marathon-ReadyTM human adrenal gland and fetal brain cDNA libraries were purchased...

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin puriﬁed from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... Sampieri, F & Granier, C (1991) An anti-insect toxin puriﬁed from the scorpion Androctonus australis Hector also acts on the a- and b-sites of the mammalian sodium channel: sequence and circular dichroism ... obtained was displayed an ORF of 258 bp encoding a polypeptide of 85 amino acids and termed BmKIM The 5¢ and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp, respectively A single AATAAA polyadenylation...

Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps

... study we have investigated the role of CCR7 in the recruitment of CD4+ memory T cells into the inflamed joints of patients with JIA, and attempted the functional and anatomical dissection of these ... degree of disease activity and treatment at the moment of sampling Expression of CCL21 in SF and synovial tissue To gain further insight into the relevance of the interactions between CCR7 and its ... aggregates in the sublining layer or scattered throughout the synovium up to the lining layer [20] Conversely, CCR5-positive cells were detected mainly in the lining layer and in the sublining zone...

báo cáo khoa học: " Molecular and functional analyses of COPT/Ctrtype copper transporter-like gene family in rice" pdf

... heteromeric interactions of COPTs AIg5, a transmembrane protein with C terminal in the cytoplasm; NubI, N-terminal half of ubiquitin protein; NubG, mutated N-terminal half of ubiquitin protein; Cub, ... COPT3 and COPT7 in shoot, and slightly suppressed COPT2 and COPT4 in root Zn deficiency induced COPT1, COPT5, and COPT7 and slightly suppressed COPT4 in root and induced COPT5, COPT6, and COPT7 in ... the ubiquitin protein (Cub) and the mutated N-terminal half of the ubiquitin protein (NubG) Cub could not interact with NubG When COPT proteins interacted, Cub and NubG were forced into close...

functional characterisation of phosphodiesterase 4d7 in prostate cancer

... and binds phosphatidic acid (PA) via a TAPAS domain in its unique N-terminal region An increase in intracellular CA2+ brings about binding of PDE4A1 to PA and insertion into lipid bilayers in an ... domain REC domains play a crucial role in bacterial signalling systems They may also be involved in protein-protein interactions (Galperin 2010) Phosphorylation of the REC domain may be involved ... location of this isozyme changed following cleavage, again showing how the N-termini of PDEs are involved in their subcellular targeting PDE4A5 can interact with the SH3 domains of SRC family kinases...

MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS

... secretion and therefore the salt tolerance mechanism in the mangrove Avicennia officinalis These results validate the previous findings that aquaporins play a critical role in salt secretion and water ... physiological and molecular aspects of salt tolerance in A officinalis The notable contributions of this study include confirmation of the role of AoDHN1 in stress remediation and identification of a ... Sections of A officinalis young and mature leaves 65 Figure 3.2: Adaxial and abaxial surfaces of A officinalis fresh and dried leaves 66 Figure 3.3: Determination of salt gland density in A officinalis...

The role of hydrogen sulphide in the cardiovascular system emphasis on haemorrhagic shock

... desensitization in isolated haemorrhagic- shocked rat mesenteric artery The authors showed that agonists of protein kinase C and antagonists of protein kinase G could inhibit the Introduction reduction in ... (IRFI-042) to haemorrhagic- shocked rats could inhibit the increase in NFκB binding activity, which in turn inhibited the rise in TNF-α concentration In the lung at least, the production of TNF-α is ... demonstrated that the ROS source leading to the increase in TNF-α concentration in haemorrhagic shock was likely the ROS produced by xanthine oxidase as the increase in TNF-α concentration was inhibited...

MOLECULAR AND FUNCTIONAL CHARACTERISATION OF THE ROLE OF HYDROGEN SULPHIDE IN SEXUAL MEDICINE

... muscles of the helicine arteries are relaxed, blood inflow to the lacunar spaces increases Relaxation of the smooth muscle of the trabeculae then dilates the lacunae, allowing for the expansion of the ... tissue against the tunica albuginea which in the process, compresses the subtunical venules against the tunica (the stretching of the tunica also compresses the emissary veins), restricting the venous ... effects of H2S may be twofold; being involved in 1) the relaxation of the corporal smooth muscle; and 2) the inhibition of the penile basal tone The nature and site of H2S effects (molecular/ cellular/neurovascular)...

Xem thêm

Từ khóa: early detection of systems response molecular and functional imaging of angiogenesis molecular and cellular aspects of mental retardation in the fragile x syndrome from gene mutation s to spine dysmorphogenesis histochemical methods neurochemistry and functional neurohistology including the molecular biology of neuron out of the green yonder molecular cloning and functional characterization of beta carotene 15 15 apos oxygenases the basic molecular and structural components of silicate clays a single tetrahedron and single octahedron b thousands of tetrahedrons and octahedrons are connected to give planes of silicon and aluminum or magnesium ions unive tên bài báo comparative evaluation of different co antioxidants on the photochemical and functional stability of epigallocatechin 3 gallate in topical creams exposed to simulated sunlight the collapse of apos classical legal thought apos and new views on the role of the judiciary asset prices and intergenerational risk sharing the role of idiosyncratic earnings shocks improving the nutritional quality and functional properties of seed proteins by genetic engineering molecular biochemical pharmacological and functional analyses of zebrafish coxs structural and functional organization of the insect retina neurogenic and functional disorders of the larynx molecular and biochemical basis of brain injury following heart surgery interventions for the future brief description of the histological cytological and functional aspects of the ovary imr90 and oxygen what is the role of p16 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ