Identification of systems from multirate data

Identification of systems from multirate data

Identification of systems from multirate data

... IDENTIFICATION OF SYSTEMS FROM MULTIRATE DATA MAY SU TUN (B.Sc (Honours) I.C YU, Yangon), (B.E (Chemical) YTU, Yangon) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF ... nature Because of their usefulness in identification of nonlinear chemical system, this thesis tries to explore the identification of these two models 1.2 Multirate Syst...
Ngày tải lên : 09/10/2015, 11:06
  • 129
  • 348
  • 0
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

... of all miR loci in the Ciona genome Altogether, miRTRAP generated an apparent false negative rate of approxi- mately 5% and a false discovery rate of approximately 19% To systematically compare ... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nis...
Ngày tải lên : 09/08/2014, 20:21
  • 12
  • 552
  • 0
Báo cáo hóa học: " Modeling Nonlinear Power Amplifiers in OFDM Systems from Subsampled Data: A Comparative Study Using " potx

Báo cáo hóa học: " Modeling Nonlinear Power Amplifiers in OFDM Systems from Subsampled Data: A Comparative Study Using " potx

... [16] as a tool to determine a reasonable delay Unlike the autocorrelation function, the mutual information takes into account also nonlinear correlations In particular, a detailed analysis that ... particular modulation format on each subcarrier 4.1 Data set analysis The training and testing sets are formed from the subsampled time-domain measurements as follows: for each bandwi...
Ngày tải lên : 23/06/2014, 01:20
  • 10
  • 265
  • 0
Isolation and identification of components from ixeris sonchifolia hance as potential anti stroke agents

Isolation and identification of components from ixeris sonchifolia hance as potential anti stroke agents

... Evaluation of antioxidant activities of fractions to isolated from Ixeris sonchifolia Hance extract 44 2.4 Discussion and conclusions Chapter Isolation and characterization of components from ethyl ... Possible anti- coagulation activities of fractions to isolated from Ixeris sonchifolia Hance extract 42 2.3.2 Effects of fractions to isolated from Ixeri...
Ngày tải lên : 11/09/2015, 10:06
  • 188
  • 422
  • 0
Báo cáo y học: "An optimization framework for unsupervised identification of rare copy number variation from SNP array data." doc

Báo cáo y học: "An optimization framework for unsupervised identification of rare copy number variation from SNP array data." doc

... other SNP arrays, including earlier versions of the Affymetrix platform, Illumina arrays, or array comparative genomic (a) 2.5 Raw copy number Raw copy number 3.0 hybridization Any platform that ... Birdsuite platform [17] QuantiSNP [26] is an analytical tool for the analysis of copy number variation using whole genome SNP genotyping data It was originally developed...
Ngày tải lên : 09/08/2014, 20:20
  • 18
  • 457
  • 0
Báo cáo y học: "Improving identification of differentially expressed genes in microarray studies using information from public databases" pptx

Báo cáo y học: "Improving identification of differentially expressed genes in microarray studies using information from public databases" pptx

... information as possible In the context of finding differentially expressed genes, the null hypothesis for each gene is that it is not differentially expressed between two groups, usually against ... the identification of differentially expressed genes essentially by gathering information across similar genes, we suggest another solution We propose estimating the na...
Ngày tải lên : 14/08/2014, 14:21
  • 10
  • 244
  • 0
Tài liệu Fertility, Family Planning, and Reproductive Health of U.S. Women: Data From the 2002 National Survey of Family Growth doc

Tài liệu Fertility, Family Planning, and Reproductive Health of U.S. Women: Data From the 2002 National Survey of Family Growth doc

... Planning, and Reproductive Health of U.S Women: Data From the 2002 National Survey of Family Growth Data From the National Survey of Family Growth U.S DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers ... c reproductive health c infertility c National Survey of Family Growth c National Center for Health Statistics Fertility,...
Ngày tải lên : 13/02/2014, 10:20
  • 174
  • 933
  • 0
An Analysis of Geometric Modeling in Database Systems docx

An Analysis of Geometric Modeling in Database Systems docx

... 1987 An Analysis of Geometric Modeling in Database Systems Conclusions In the first part of this paper we investigated the requirements imposed on database management systems by computer-aided manufacturing ... allows the engineer to specify and manipulate real-world objects interactively ACM Computing Surveys, Vol 19, No 1, March 1987 An Analysis of Geometric...
Ngày tải lên : 07/03/2014, 23:20
  • 45
  • 380
  • 0
Báo cáo khoa học: "Automatic Identification of Word Translations from Unrelated English and German Corpora" pot

Báo cáo khoa học: "Automatic Identification of Word Translations from Unrelated English and German Corpora" pot

... terms of corpus frequencies: kl~ = frequency of common occurrence of word A and word B kl2 = corpus frequency of word A - kll k21 = corpus frequency of word B - kll k22 = size of corpus (no of tokens) ... number of resources were required These are a German corpus an English corpus a number of German test words with known English translations a small base...
Ngày tải lên : 08/03/2014, 06:20
  • 8
  • 438
  • 0
From Patient Data to Medical Knowledge The Principles and Practice of Health Informatics ppt

From Patient Data to Medical Knowledge The Principles and Practice of Health Informatics ppt

... to listen more constructively to their patients’ stories if they tried to understand them as stories, rather than attempting to express them in the structured and standardised format of the medical ... From Patient Data to Medical Knowledge The Principles and Practice of Health Informatics To Ailsa and Ewan In real life a mathematical propositio...
Ngày tải lên : 15/03/2014, 12:20
  • 274
  • 1K
  • 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

... KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAG...
Ngày tải lên : 16/03/2014, 04:20
  • 12
  • 445
  • 0
Báo cáo khoa học: "Learning the Countability of English Nouns from Corpus Data" ppt

Báo cáo khoa học: "Learning the Countability of English Nouns from Corpus Data" ppt

... target noun vs the number of the head nouns of conjuncts (e.g dogs and mud = PLURAL,SINGULAR ) N of N constructions:2D the number of the target noun (N ) vs the type of the N in an N of N construction ... randomlyselected nouns from the test data, and tested the correlation with the system output This is intended to test the ability of the system...
Ngày tải lên : 17/03/2014, 06:20
  • 8
  • 349
  • 0
Support to the identification of potential risks for the environment and human health arising from hydrocarbons operations involving hydraulic fracturing in Europe doc

Support to the identification of potential risks for the environment and human health arising from hydrocarbons operations involving hydraulic fracturing in Europe doc

... viii Support to the identification of potential risks for the environment and human health arising from hydrocarbons operations involving hydraulic fracturing in Europe Runoff and erosion during ... xviii Support to the identification of potential risks for the environment and human health arising from hydrocarbons...
Ngày tải lên : 23/03/2014, 00:20
  • 292
  • 586
  • 0
Báo cáo khoa học: "Learning from evolving data streams: online triage of bug reports" potx

Báo cáo khoa học: "Learning from evolving data streams: online triage of bug reports" potx

... description of issue Content of issue report, which may include steps to reproduce, error messages, stack traces etc ID of report submitter List of IDs of people CC’d on the issue report List of tags ... development data streams The horizontal lines indicate the mean MRR scores for the whole stream The curves show a moving average of MRR in a window comprised of 7% of the...
Ngày tải lên : 24/03/2014, 03:20
  • 10
  • 432
  • 0
Information Management Resource Kit Module on Management of Electronic DocumentsUNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 6. TEXTUAL DATABASES AND CDS/ISIS BASICSNOTE Please note that this PDF version does not have the interactive features offered th doc

Information Management Resource Kit Module on Management of Electronic DocumentsUNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 6. TEXTUAL DATABASES AND CDS/ISIS BASICSNOTE Please note that this PDF version does not have the interactive features offered th doc

... Objectives At the end of this lesson, you will: • understand the functionalities offered by CDS/ISIS, a textual DBMS; • understand the technical work needed by developers to implement these functionalities; ... understanding of the concepts covered in this lesson Good luck! Exercise What is CDS/ISIS? A set of tools for relational database management A textual...
Ngày tải lên : 31/03/2014, 20:20
  • 17
  • 343
  • 0