Expression and characterization of FAT1 and atrophin 1 proteins regulating planar cell polarity and MBD1 protein involved in lymphoma

Expression and characterization of FAT1 and atrophin 1 proteins regulating planar cell polarity and MBD1 protein involved in lymphoma

Expression and characterization of FAT1 and atrophin 1 proteins regulating planar cell polarity and MBD1 protein involved in lymphoma

... 3 .1. 1 Cloning of C-terminal Fat1 30 3 .1. 2 Cloning of C-terminal Atrophin1 31 3 .1. 3 Blue white colony screening 32 3.2 33 Subcloning Of Fat1 and Atrophin1 3.2 .1 Touch up PCR for Fat1 and Atrophin1 ... understanding the roles of Fat1 and Atrophin1 in the mechanism of regulation in planar cell polarity MBD1 or Methyl binding domain protein belon...

Ngày tải lên: 05/10/2015, 22:31

92 1,3K 0
Báo cáo y học: " Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency" docx

Báo cáo y học: " Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency" docx

... for their role in maintaining HIV1 latency The only purpose of our microarray analysis was to identify candidate genes potentially involved in the control of the HIV latency For this reason, we ... latency In this study, the role of the HDAC inhibitor NaB on HIV-1 latently infected cells gene expression was explored using microarrays Since chromatin remodeling...

Ngày tải lên: 13/08/2014, 09:21

14 316 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... from the oyster Crassostrea gigas [5] Interestingly, this protein, named C gigas chitinase-like protein (CgClp1) was found to be involved in the control of growth and remodelling processes in a ... composed of the sole Glyco_18 domain, the C-terminal tail of C gigas CLPs may not noticeably contribute to the structure and the function of these proteins...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

... significant Western blotting of the small leucine-rich proteoglycans Western blot analysis of extracts of an equivalent dry weight of pooled LTP cartilage from control and meniscectomized joints and ... glycosylated, and that nonglycosylated biglycan and decorin are more abundant in OA cartilage [20] Changes in glycosylation of the SLRPs, whether by altered synth...

Ngày tải lên: 09/08/2014, 06:23

10 416 0
Báo cáo y học: "Candida albicans induces cyclo-oxygenase 2 expression and prostaglandin E2 production in synovial fibroblasts through an extracellular-regulated kinase 1/2 dependent pathway" pps

Báo cáo y học: "Candida albicans induces cyclo-oxygenase 2 expression and prostaglandin E2 production in synovial fibroblasts through an extracellular-regulated kinase 1/2 dependent pathway" pps

... chamber interaction and subsequent assessment of COX -2 gene expression in synovial fibroblasts (lanes and 2) and C albicans (lane 3) Lane 1: synovial fibroblasts in the upper chamber and no C albicans ... Micro-oganisms of all types, mostly bacterial infections, can produce an infectious arthritis associated with COX -2 induction and prostaglandin E2 (PGE...

Ngày tải lên: 09/08/2014, 14:20

9 403 0
báo cáo khoa học: " Field transcriptome revealed critical developmental and physiological transitions involved in the expression of growth potential in japonica rice" potx

báo cáo khoa học: " Field transcriptome revealed critical developmental and physiological transitions involved in the expression of growth potential in japonica rice" potx

... characterization of genes but also revealed critical developmental and physiological transitions involved in the expression of growth potential under natural field conditions With the accompanying gene expression ... this article as: Sato et al.: Field transcriptome revealed critical developmental and physiological transitions involved in...

Ngày tải lên: 11/08/2014, 11:21

15 323 0
Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

... 67Ga-transferrin from the intravascular to the extravascular spaces in the lungs, and it is therefore a measure of pulmonary capillary permeability to transferrin [19 ,20] The mean PLI from the two lungs ... pulmonary leak index can be measured as an index of capillary permeability and lung injury In patients with HSV -1 from tracheal aspirate or bronchoalveloa...

Ngày tải lên: 12/08/2014, 20:20

6 284 0
Báo cáo khoa học: Association of RNA with the uracil-DNA-degrading factor has major conformational effects and is potentially involved in protein folding pot

Báo cáo khoa học: Association of RNA with the uracil-DNA-degrading factor has major conformational effects and is potentially involved in protein folding pot

... suggesting that DNA is able to replace RNA in RNAUDE, in agreement with the overlap of the respective binding sites These ndings can be interpreted within the previously introduced hypothesis that RNAUDE ... abundant in this recombinant overexpression system; domain V of the 23S rRNA, which is known to be involved in assisting de novo protein folding during t...

Ngày tải lên: 22/03/2014, 16:21

21 465 0
Báo cáo khoa học: Characterization of mucin-type core-1 b1-3 galactosyltransferase homologous enzymes in Drosophila melanogaster pptx

Báo cáo khoa học: Characterization of mucin-type core-1 b1-3 galactosyltransferase homologous enzymes in Drosophila melanogaster pptx

... abrogating peanut agglutinin binding Furthermore, the peanut agglutinin staining in the developing nervous system documented by D’Amico and Jacobs [8] could not be confirmed in our in situ hybridization ... suggesting that some of these inactive proteins may act like cosmc as chaperones for core-1 b3GalT However, the combined coexpression of active and inactive D melanogaster co...

Ngày tải lên: 23/03/2014, 15:20

11 467 0
Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx

Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx

... These sites bind Sp1 and Sp3, and protein levels and binding of Sp1 and Sp3 are increased in PMAtreated cells These findings indicate that Sp1 and Sp3 play a pivotal role in the transcriptional ... and Sp3 are able to bind to the GC boxes and that binding of Sp1 forms complex C1 and binding of Sp3 forms complexes C2 and C3 PMA treatment increa...

Ngày tải lên: 23/03/2014, 17:21

8 447 0
Báo cáo khoa học: Biochemical characterization of the native Kv2.1 potassium channel ppt

Báo cáo khoa học: Biochemical characterization of the native Kv2.1 potassium channel ppt

... guide for biochemical purification of other potassium channels Results Expression and biochemical characterization of native Kv2.1 Regional distribution in various rat tissues of Kv2.1 channel protein ... from recombinant cell lines Here we report the biochemical characterization of Kv2.1 protein complexes The biochemical profile of the Kv2.1 potassium...

Ngày tải lên: 30/03/2014, 20:20

13 330 0
báo cáo khoa học: " Dissection of genetic and environmental factors involved in tomato organoleptic quality" doc

báo cáo khoa học: " Dissection of genetic and environmental factors involved in tomato organoleptic quality" doc

... biochemical factors are mainly involved in tomato fruit flavour determination Network analysis was able to reduce data complexity by focusing on key information of the full data set A number of links ... contributing to fruit organoleptic quality and to the perception of sensory attributes were identified [21] In order to gain a clearer understanding of the biochemical...

Ngày tải lên: 11/08/2014, 11:21

10 207 0
báo cáo khoa học: " Plant origin and ploidy influence gene expression and life cycle characteristics in an invasive weed" ppsx

báo cáo khoa học: " Plant origin and ploidy influence gene expression and life cycle characteristics in an invasive weed" ppsx

... importance of determining plant ploidy in ecological and genomics investigations, and suggests that C stoebe invasion can be influenced by both plant ploidy and altered gene expression in the introduced ... Panel B: Genes involved in defense response; Chit (chitinase) and Gluc (glucanase); Panel C: Gene involved in transposition; TE (transposable element); Panel...

Ngày tải lên: 12/08/2014, 03:20

13 299 0
Báo cáo y học: " Phosphodiesterase type 4 expression and anti-proliferative effects in human pulmonary artery smooth muscle cells" docx

Báo cáo y học: " Phosphodiesterase type 4 expression and anti-proliferative effects in human pulmonary artery smooth muscle cells" docx

... A in E4 DE4 DE4 DE4 Act T NA P P P PD -R -R 500 bp 300 bp 100 bp Figure artery smooth (PDE4) expression in human pulmonary Phosphodiesterase typemuscle cells Phosphodiesterase type (PDE4) expression ... monocrotaline- [43 ] and hypoxia-induced rat models of pulmonary hypertension [15], the anti-proliferative effects of iloprost in vivo being potentiated by the...

Ngày tải lên: 12/08/2014, 16:20

12 249 0
Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx

Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx

... TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5′-GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5′-ACCAACTGGGACGACATGGAGAAA; ACTBR, 5′-TAGCACAGCCTGGATAGCAACGTA The DKK1b primer pair was used for standard PCR amplification of ... HTLV-I antisense transcripts initiate in the 3’LTR and are alternatively spliced and polyadenylated Retrovirology 2006, 3:15 59 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguch...

Ngày tải lên: 13/08/2014, 01:20

16 461 0
w