Effects of lattice legs and sleeves on spudcan penetration performance
... EFFECTS OF LATTICE LEGS AND SLEEVES ON SPUDCAN PENETRATION PERFORMANCE SIM WEE KEAT (BEng., Hons) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF CIVIL ENGINEERING ... NORMALLY CONSOLIDATED CLAY 74 4.3.2 OVER-CONSOLIDATED CLAY 75 SLEEVED SPUDCAN PENETRATION RESPONSE OF SPUDCANS WITH LATTICE LEGS AND SLEEVES 75 4.4.1 NORMALLY CON...
Ngày tải lên: 05/10/2015, 13:53
... in the costs of the regional banks’ deposits and wholesale debt funding, and the large switch in their funding mix from securitisation to deposits, currently a relatively expensive source of funding ... debt funding costs Currently they are around the average level of the past five years The above analysis broadly demonstrates that some of the increase i...
Ngày tải lên: 29/03/2014, 01:20
... 47], P pinaster [6, 30] and Pinus strobus [43] A partial explanation may lie in a positive relationship between the concentration of P and amount of Rubisco, as observed in P pinaster [55] and in ... and photosynthesis of maritime pine Figure Relationship between stable carbon isotope composition (δ13C) and (a) needle N concentration, (b) needle P conce...
Ngày tải lên: 08/08/2014, 00:21
Báo cáo lâm nghiệp: "Effects of high temperatures and ash on seed germination of two Iberian pines (Pinus nigra ssp salzmannii, P sylvestris var iberica)" pps
... 1973) and P nigra nigra / Pinus sylvestris / température (Orlandini and Malcoste, 1972) P halepensis and P pinaster, two common Iberian pines, have been characterized as typical pyrophytes, which ... stress on the germination of Pinus halepensis and P brutia seeds Seed Sci Technol 15, 163-174 Toole VK (1973) Effects of light, temperature and their interact...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo y học: "Effects of ischemic pre- and postconditioning on HIF-1a, VEGF and TGF-b expression after warm ischemia and reperfusion in the rat liver" ppsx
... al.: Effects of ischemic pre- and postconditioning on HIF-1a, VEGF and TGF-b expression after warm ischemia and reperfusion in the rat liver Comparative Hepatology 2011 10:3 • Inclusion in PubMed, ... preconditioning + 30 of ischemia IPO, 30 ischemia + ischemic postconditioning IPC+IPO, ischemic preconditioning + 30 of ischemia + ischem...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Neuroprotective effects of ginsenosides Rh1 and Rg2 on neuronal cells" pot
... models of neuronal cell death [40-42] The present study aims to evaluate the effects of ginsenosides Rh1 and Rg2 on neuroprotection, cell differentiation and on ERK activation in neuronal cells ... percentage of PC12 cells possessing neurites was more than that of control (Figure 3b) 6-OHDA and ginsenosides cytotoxicity Cytotoxicity of 6-OHDA and ginsenosi...
Ngày tải lên: 13/08/2014, 14:20
Interactive Effects of Elevated CO2 and Salinity on Three Common Grass Species
... Research Integrity and Copyright Disclaimer Title of Thesis/Dissertation: Interactive Effects of Elevated CO2 and Salinity on Three Common Grass Species For the degree of Master of Science I certify ... Moxley, Donovan J M.S., Purdue University, August 2012 Interactive Effects of Elevated CO2 and Salinity on Three Common Grass Species Ma...
Ngày tải lên: 24/08/2014, 12:30
Studies on the mechanisms of the beneficial effects of herba leonuri and leonurine on traumatic brain injury in rat
... primary and secondary injury mechanisms The primary injury refers to the direct effects of mechanical injury on the brain tissue A primary injury can incur focal and/ or diffuse damage to the brain ... type of brain injury The pathology of brain injury includes cortical contusion, hemorrhage and a cytotoxic and/ or vasogenic brain edema which...
Ngày tải lên: 02/10/2015, 17:15
Physical effects of nano particles and polymer on vesicles
... vesicles concentration The effects of ion charges of aqueous solution and time factor on the interactions are also studied The nature of the interactions was further understood by the means of ... Critical concentration of microspheres in DLS 57 Figure 18: Critical concentration of gold nanoparticles in DLS 58 Figure 19: Illustrations of effect of microspheres on Egg...
Ngày tải lên: 16/10/2015, 15:39
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo Y học: Differential effects of arachidonoyl trifluoromethyl ketone on arachidonic acid release and lipid mediator biosynthesis by human neutrophils pot
... studies by demonstrating that inhibition of LTB4 and PAF biosynthesis by AACOCF3 occurs without concomitant inhibition of AA release Generation of the common precursor pool by CoA-IT occurs by the ... activation is accompanied by an increase in PAF biosynthesis via acetylation of 1-alkyl-2-lyso-GPC by acetyl transferase (Fig 8, f) activity, competition for 1-alkyl-...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx
... trapping of Pgp also occurs in live cells Coupling of Pgp-mediated drug transport and ATP hydrolysis are generally interpreted in terms of ligandinduced ATPase activation and concomitant transitions ... labeling after UIC2 binding) may be intrinsic to the normal catalytic cycle, or, alternatively, the CsA-type drugs may induce a special conformation adopted by Pgp only...
Ngày tải lên: 08/03/2014, 23:20
The Effects of Inorganic Salts and Precipitated Calcium Carbonate Filler on the Hydrolysis Kinetics of Alkylketene Dimer docx
... in the programs and activities which the Institute operates The Effects of Inorganic Salts and Precipitated Calcium Carbonate Filler on the Hydrolysis Kinetics of Alkylketene Dimer Hui JiangandYulin ... after the hydrolysis reaction if the reaction solutionwas unbuffered Sincethe AKD hydrolysis rate is very sensitiveto the solution pH, the e...
Ngày tải lên: 09/03/2014, 01:20
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... conformation of this loop Changes in the conformation of the backbone at this point and changes in the orientation of other side chains, as a result of the introduction of the large charged aspartate ... Centre for Structural and Functional Genomics) for running many of the analytical ultracentrifugation samples, A Padovani for making the W56F variant...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt
... measure the binding, insertion and aggregation of molecules, either at the lipid bilayer surface or upon incorporation into the bilayer The principles of creating a self-assembled single solid-supported ... aggregation and neurotoxic action, in particular the presence of sphingomyelin, cholesterol and zinc ions Results and Discussion In order to...
Ngày tải lên: 30/03/2014, 11:20