Effects of exposure to environmental mycobacteria on immunity conferred by bacille calmette guerin (BCG) vaccine

... induction of regulatory T cells by M chelonae sensitisation 60 5.5 Role of IFN-γ in cytotoxic responses 62 5.6 Effects of Env sensitisation on BCG-induced immunity 63 5.7 Conclusion ... that the efficacy of Mycobacterium bovis bacille Calmette- Guérin (BCG), as a tuberculosis (TB) vaccine in human populations, is influenced by prior sensitisation to environmental...

Ngày tải lên: 05/10/2015, 13:53

... on bare-root red oak seedlings in terms of survival and growth after planting The effects of exposure appeared to be related to the desiccation of the different plant components rather than to ... tissues (absence of foliage and fine roots, predominance of reserve tissues of the taproot) in the exposed red oaks compared with the coniferous species as CONCLUSI...

Ngày tải lên: 08/08/2014, 18:21

... exposure Male Reproductive Health Disorders and the Potential Role of Environmental Chemical Exposures Overview of prevalence and trends in male reproductive health disorders The reproductive disorders ... 2008, 2009) and by binding to and blocking the AR (Wilson et al 2008), and these will also induce some of the TDS disorders Male R...

Ngày tải lên: 13/02/2014, 10:20

... of a Working Group convened by WHO to examine several of these aspects as they apply specifically to air pollution health impact assessments The quality of estimates of health impacts of air pollution ... magnitude of the effect of air pollution on daily morbidity and mortality varies among locations, and that factors such as the nature and level of...

Ngày tải lên: 17/02/2014, 11:20

... contributing to the exacerbation of asthma [23-27] These observations show that the barn air contains toxic molecules which induce lung dysfunction in pig barn workers Effects of acute single exposure to ... to the swine barn air: human studies To better understand the negative effects of exposure to swine barn air, many researchers have exposed naïve, health...

Ngày tải lên: 20/06/2014, 00:20

... Table 3: Relation between different levels of exposure to ETS and respiratory symptoms/diagnosis among adult non-smokers in Aleppo-Syria (n = 1118) ETS score* Self-reported respiratory symptoms/diagnoses ... health and disability, chronic disease, respiratory health, household members' health, environmental health, smoking, and ETS exposure For the assessment o...

Ngày tải lên: 12/08/2014, 18:21

... 3.3.1 Cell subsets involved in cytotoxicity .49 3.3.2 Mediators of cytotoxicity .53 3.3.3 Specificity of cytotoxic responses 53 3.3.4 Effect of Env sensitisation on live BCG infection ... The broad aims of the project were: 1) In CHE‐sensitised mice, to analyse the role of different cell types, cytokine factors and mediators of cytotoxicity on the host’s responses to BCG,...

Ngày tải lên: 10/09/2015, 15:51

... to the best of our knowledge, the first ever study of the health effects of air pollution in Ho Chi Minh City In addition, it focuses on a much-understudied children s health outcome, acute lower ... unit of observation is daily counts of hospital admissions for acute lower respiratory infection We used Poisson regression with smoothing functio...

Ngày tải lên: 13/09/2015, 17:48

... http://www.jneuroinflammation.com/content/4/1/10 Figure Low dose of GM-CSF influences microglial CD40 expression in response to S aureus Low dose of GM-CSF influences microglial CD40 expression in response to S aureus ... and CD86 by flow cytometry to determine the possible effects of low dose GM-CSF on http://www.jneuroinflammation.com/content/4/1/10 mi...

Ngày tải lên: 19/06/2014, 22:20

... used as the model Gram-positive species to systematically investigate the effects of electrochemical currents on bacteria including the morphology, viability, and gene expression of planktonic cells, ... (henceforth ECs) To better understand the mechanism of bacterial control by ECs, we conducted a systematic study of the effects of weak ECs on the...

Ngày tải lên: 20/06/2014, 23:20

Ngày tải lên: 15/10/2014, 07:58

... the effects of stranded oil on tidal flat ecosystems with special emphasis on the relationship between seawater infiltration and macrobenthic community using tidal flat ecosystem simulators TIDAL ... at day 23 and 58 in the C and O simulators Fig.8 shows infiltration rate of seawater by tidal action both in the C and O simulators The infiltration...

Ngày tải lên: 05/09/2013, 08:40

... in total organic carbon concentration resulted from the oxidation of carbon to carbon dioxide by microorganisms during composting (Tiquia et al., 1996) Throughout the composting process, total ... 77 84 Composting time (day) Figure Changes in moisture content during composting of cassava pulp with swine manure Total organic carbon and total nitrogen Durin...

Ngày tải lên: 05/09/2013, 09:08

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên: 18/02/2014, 11:20

... membrane Interactions between VVA1 and VVA2 B Fig Effects of volvatoxin A1 (VVA1) on the hemolytic and cytotoxic activity of volvatoxin A2 (VVA2) (A) The hemolytic activity of VVA2 regulated by VVA1 ... VVA2 can use VVA1 as a basis for the formation of VVA2 oligomers Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites in VVA1 respo...

Ngày tải lên: 19/02/2014, 06:20