Discovery of safe anti dengue virus drugs from libraries of FDA approved drugs and plants through screening against viral RNA dependent RNA polymerase activity

... system-produced NS5 proteins 86 4.3 Screening libraries of FDA- approved drugs and natural compounds 88 4.4 Primary screening of libraries of FDA- approved drugs and natural compounds in in vitro ... for the development of anti- dengue therapeutics In this study, the discovery of antiviral drugs against dengue will be focused upon 21 1.4.1 Ideal char...

Ngày tải lên: 04/10/2015, 16:03

... Nef) Therefore, inclusion of these epitopes may potentially enhance the efficiency of a multi-epitope vaccine across a broader range of host HLA haplotypes Page of 12 (page number not for citation ... into a single, "unique" rule regardless of the order of epitopes within a rule (i.e., A occurs with B and B occurs with A are considered the same "unique" rule) $ i.e., ass...

Ngày tải lên: 12/08/2014, 23:21

... The Biology of Coronavirus 1.1 Overview of Coronaviruses 1.1.1 Taxonomy, genomic and physical properties of Coronaviruses Coronaviruses are a group of enveloped RNA viruses whose genome is in ... (+)mRNA 3’ (+)mRNA Figure 1.5: The transcription of gammacoronavirus IBV produces a nested set of positive-sense mRNAs that are 5'- and 3'- co-terminal (+) gRNA is mRNA1 an...

Ngày tải lên: 09/09/2015, 18:54

... the synovium synthase- 1, 2, and -3 and (OA) levels of the messages (RA) Relative expressionand rheumatoid arthritis for hyaluronanof knees in 2, and -3 and hyaluronidase- 1, -2, and -3 in the synovium ... is determined by the production volume of hyaluronan, the elimination volume of hyaluronan from the joint, and the total volume of joi...

Ngày tải lên: 09/08/2014, 01:24

... BIOLOGY OF DENGUE VIRUS 1.2.1 Taxonomy of dengue virus Dengue virus (DENV) belongs to the family of Flaviviridae that consists of three genera, flavivirus (e.g dengue virus, West Nile virus, and ... BIOLOGY OF DENGUE VIRUS 1.2.1 Taxonomy of dengue virus 1.2.2 Structure and genetic organization of dengue virus 1.2.3 Viral infection cycle 1.2.4...

Ngày tải lên: 10/09/2015, 15:51

... treatment "" 340 7"" "" " "" " "" " "" " "" " "" " "" " "" 8 04 7"" "" " "" " "" " "" " "" " "" " "" " "" " 5034 7"" "" " "" " "" " "" " "" " "" " "" 3 078 5"" "" " "" " "" " "" " "" " "" " "" " "" " 2"" "" " "" " "" " "" " "" " "" " Dandelion, concentration (mg/ml) Virus control ... mice immunized by PR8), two-fold dilution "" "" " "" " "" " "" " "2 0 8"" "" " "" " "" "...

Ngày tải lên: 11/08/2014, 21:22

... profiles of each compound Statistical significance was evaluated with one-way analysis of variance (one-way ANOVA) A value of P < 0.05 was considered statistically significant Enzyme hydrolysis ... 4:19 Background Zingiber cassumunar (Z cassumunar, cassumunar ginger) and Nigella sativa (N sativa, black cumin) are widely used as single herbs or as components of herbal fo...

Ngày tải lên: 13/08/2014, 15:21

Ngày tải lên: 09/09/2015, 11:16

... anti -influenza virus antibodies Serum from subjects with past history of influenza virus vaccination or no infection was incubated with nitrocellulose strips containing influenza virus vaccine ... and elevated in adults and children vaccinated with Influenza virus Children with no history of either Influenza virus infection or vaccination had s...

Ngày tải lên: 25/10/2012, 11:10

... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR...

Ngày tải lên: 14/02/2014, 19:20

... s)1, Km of 0.148 ± 0.028 mm and kcat ⁄ Km of 5.2 · 104 m)1Æs)1 toward shikimate, and a kcat of 7.1 ± 0.7 s)1, Km of 0.182 ± 0.027 mm and kcat ⁄ Km of 3.9 · 104 m)1Æs)1 toward NADP Different from ... metabolism of H pylori Recently, the three-dimensional structures of AroE from several bacteria such as E coli, Methanococcus jannaschii, and H influenzae, and YdiB...

Ngày tải lên: 19/02/2014, 05:20

... alanine scanning of the L-CDR3 and H-CDR3 loops of antibody mAb4E11 This scanning allowed us to identify the residues of these loops that contributed to the energetics and kinetics of the interaction ... on antibodies and their genes, and performed a systematic scanning of the CDR3 loops of mAb4E11 by mutagenesis of their residues into alanine (Ala scanni...

Ngày tải lên: 19/02/2014, 07:20

... sp strain RHA1 The bacterial oxidase was found to be most active with eugenol, and hence has been named eugenol oxidase (EUGO) Results Properties and spectral characterization of EUGO EUGO can ... bound Covalent flavinylation was accompanied by an increase in oxidase activity and formation of hydrogen peroxide This confirms a mechanism of autocatalytic covalent flavinylation...

Ngày tải lên: 07/03/2014, 09:20

... refer to the sequences that are present in the genome of interest and absent from the host genome as being ‘host-blind’ (human- blind, mosquito-blind, mouseblind, rat-blind, etc.) sequences The greater ... (22-mers) of the viral genome is comprised of n-mers that are not present in any of the other dengue genomes For example, in the genome o...

Ngày tải lên: 23/03/2014, 11:20

... Research with a Series of Reading Tasks In Proceedings of LREC 2010 1475 Fabian M Suchanek, Gjergji Kasneci, and Gerhard Weikum 2007 Yago: a core of semantic knowledge In Proceedings of the 16th international ... modifier of “Steve Young” Similar information can be gained from appositions (e.g., “Steve Young, the quarterback of his team, said ”), and copula verbs (“Steve Young...

Ngày tải lên: 23/03/2014, 16:20