Development of a therapeutic trans sclera illuminated laser delivery device for retinal pathologies

Development of a therapeutic trans sclera illuminated laser delivery device for retinal pathologies

Development of a therapeutic trans sclera illuminated laser delivery device for retinal pathologies

... Clockwise – Translate downward Rotate Anti-clockwise – Translate upward Translate left Translate backward Translate forward Translate right Figure 1.10d: Current method – Translational motion of the ... DEVELOPMENT OF A THERAPEUTIC TRANS – SCLERA ILLUMINATED LASER DELIVERY DEVICE FOR RETINAL PATHOLOGIES TEO KENG SIANG RICHARD (M.B.B.S, NUS) A THESIS SUBMITTED FO...
Ngày tải lên : 04/10/2015, 15:52
129 199 0
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamH...
Ngày tải lên : 30/03/2014, 20:20
9 380 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/liz...
Ngày tải lên : 07/08/2014, 18:21
6 347 0
báo cáo khoa học: "Development of a primary care-based complex care management intervention for chronically ill patients at high risk for hospitalization: a study protocol" potx

báo cáo khoa học: "Development of a primary care-based complex care management intervention for chronically ill patients at high risk for hospitalization: a study protocol" potx

... as well as care organization contributes to avoidable hospitalizations and to what extent care management may be able to implement strategies that target the revealed mechanisms As implementation ... development of a complex HCA-led care management intervention for chronically ill patients that aims to implement strategies to reduce avoidable hospitalizations in Germ...
Ngày tải lên : 10/08/2014, 10:23
7 335 0
Development of a windows based computer aided die design system for die casting

Development of a windows based computer aided die design system for die casting

... Du Xiaojun, Cao Jian, Saravanakumar Mohanraj, Atiqur Rahman and Low Leng Hwa Maria Financial assistance in the form of research scholarship from the National University of Singapore is also sincerely ... prototype die casting die design system on a commercial solidsbased CAD platform Since die casting die design has been increasingly carried out on solids -based CAD...
Ngày tải lên : 04/10/2015, 15:52
121 649 0
development of a biosensor based on laser fabricated

development of a biosensor based on laser fabricated

... the DNA concentration of 0.5 ␮M According to the calibration, the increased deflection indicates that the cantilever bends downward, away from the DNA-coated side (the probe DNA is coated on the ... Hagan, A K Chakraborty, and A Majumdar, Proc Natl Acad Sci U.S .A 98, 1560 (2001) G Wu, R H Datar, K M Hansen, T Thundat, R J Cote, and A Majumdar, Nat Biotechnol 19, 856 (2001) C A Sa...
Ngày tải lên : 06/05/2014, 08:55
3 351 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...
Ngày tải lên : 03/04/2013, 21:07
10 781 3
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...
Ngày tải lên : 28/10/2013, 11:15
10 583 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...
Ngày tải lên : 18/02/2014, 17:20
11 873 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...
Ngày tải lên : 05/03/2014, 14:20
6 524 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên : 07/03/2014, 16:20
14 473 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...
Ngày tải lên : 14/03/2014, 13:20
14 402 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf

Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf

... inverse The increase of photon intensity of one mode makes the decrease of the one of other mode The reason perhaps is due to the conservation of energy in the operation of two-mode random microlaser ... operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation of mode photon densitie...
Ngày tải lên : 14/03/2014, 13:20
4 343 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...
Ngày tải lên : 15/03/2014, 00:20
15 479 0