Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Ngày tải lên : 30/03/2014, 20:20
... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced ... CA, USA) as a template PCR was carried out as described above using the forward primer (5¢-AATTCTGCAGTCGACGGT AC-3¢) and the reverse primer (5¢-GATTATGAATTCG AGTCGCGGCCGCTTTACTT-3¢) An EcoRI site...
9 380 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

Ngày tải lên : 07/08/2014, 18:21
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... revo egatnavda eht evah yam yassa siht ,ralucitrap nI selpmas lacinilc ni suriv DMF fo noitceted elbailer dna etarucca ,dipar eht rof elbatius si yassa RCP -TR T/R detamotua eht taht etartsnomed ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/42A...
6 347 0
báo cáo khoa học: "Development of a primary care-based complex care management intervention for chronically ill patients at high risk for hospitalization: a study protocol" potx

báo cáo khoa học: "Development of a primary care-based complex care management intervention for chronically ill patients at high risk for hospitalization: a study protocol" potx

Ngày tải lên : 10/08/2014, 10:23
... internist) and a small number of healthcare assistants (HCAs), who have few clinical tasks HCAs are trained in a three-year part-time curriculum in practice and vocational school Despite some recent approaches ... as well as care organization contributes to avoidable hospitalizations and to what extent care management may be able to implement strategies that target the revealed mechanisms As implementation ... hospitalization (LOH) for all patients from participating practices based on insurance claims data including hospital and ambulatory diagnosis The software package ‘Case Smart Suite Germany’ (CSSG 0.6,...
7 335 0
Development of a therapeutic trans sclera illuminated laser delivery device for retinal pathologies

Development of a therapeutic trans sclera illuminated laser delivery device for retinal pathologies

Ngày tải lên : 04/10/2015, 15:52
... Clockwise – Translate downward Rotate Anti-clockwise – Translate upward Translate left Translate backward Translate forward Translate right Figure 1.10d: Current method – Translational motion of the ... Normally, it is aligned with the slit beam camera in a same path Laser Path Slit lamp camera (With light source and magnification) For observation of patient’s eye Laser Tower Figure 1.1 0a: Carl ... system such that it is not clinically applicable Thus it is inevitable that direct tracking of the retina has to be in place for accurate and automated practical application of laser in the posterior...
129 199 0
Development of a windows based computer aided die design system for die casting

Development of a windows based computer aided die design system for die casting

Ngày tải lên : 04/10/2015, 15:52
... Du Xiaojun, Cao Jian, Saravanakumar Mohanraj, Atiqur Rahman and Low Leng Hwa Maria Financial assistance in the form of research scholarship from the National University of Singapore is also sincerely ... essential for the quick development of a low cost die, as well as to facilitate accuracy in simulation Both Zhang et al [13] and Tai et al [5] developed a CAD/CAE system for die casting The idea was ... Object-Oriented Handling of code and data Code and data are kept separate Changes made to any of the code sets and data sets can cause problems through out the system Code and data are merged into...
121 649 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT...
14 473 0
Báo cáo hóa học: " On the Ulam-Hyers stability of a quadratic functional equation" ppt

Báo cáo hóa học: " On the Ulam-Hyers stability of a quadratic functional equation" ppt

Ngày tải lên : 20/06/2014, 22:20
... Ulam-Hyers stability of the quadratic functional equation Recently, Shakeri, Saadati and Park [10] investigated the Ulam-Hyers stability of Equation (1.1) in non-Archimedean L -fuzzy normed spaces ... for a class of functional equations Stochastica 4, 23–30 (1980) doi:10.1080/17442508008833155 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings ... true quadratic mapping near an approximately quadratic mapping Theorem 3.2 Assume that a mapping f : X ® Y satisfies f(0) = and inequality (3.3) Then there exists a unique quadratic mapping Q...
9 362 0
Báo cáo hóa học: " Research Article Intuitionistic Fuzzy Stability of a Quadratic Functional Equation" pptx

Báo cáo hóa học: " Research Article Intuitionistic Fuzzy Stability of a Quadratic Functional Equation" pptx

Ngày tải lên : 21/06/2014, 07:20
... stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, vol 2, pp 64–66, 1950 T M Rassias, “On the stability of the linear mapping in Banach spaces,” ... Theory and Applications The paper of Rassias has provided a lot of influence in the development of what we called the generalized Hyers-Ulam-Rassias stability of functional equations In 1990, Rassias ... NY, USA, 1960 D H Hyers, “On the stability of the linear functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, pp 222 224 , 1941 T Aoki,...
7 348 0
Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Ngày tải lên : 22/06/2014, 02:20
... equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, no 4, pp 222 224 , 1941 D H Hyers, G Isac, and Th M Rassias, Stability of Functional Equations ... Journal of Mathematical Analysis and Applications, vol 222 , no 1, pp 126–137, 1998 17 L Hormander, The Analysis of Linear Partial Differential Operators I Distribution Theory and Fourier ¨ Analysis, ... cubic functional equation in the spaces of generalized functions,” Journal of Inequalities and Applications, vol 2007, Article ID 79893, 13 pages, 2007 15 Pl Kannappan, “Quadratic functional equation...
12 311 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package

Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package

Ngày tải lên : 11/09/2015, 14:24
... “Modeling and application of elastomer mesh for microwave probing,” IEE proceedings on Microwaves, Antennas and Propagation, Vol.153, No 1, pp.83-88, Feb 2006 J Jayabalan, R Jayaganthan, A. A.O Andrew ... availability of better CAD tools for the extraction of inductances and capacitances makes the PEEC models attractive PEECs are equivalent to Maxwell’s equations in the limit of an infinite lattice ... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI- GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore...
202 532 0
Báo cáo hóa học   research article a fixed point approach to the stability of a quadratic functional equation in c∗  alg

Báo cáo hóa học research article a fixed point approach to the stability of a quadratic functional equation in c∗ alg

Ngày tải lên : 20/12/2015, 08:14
... Journal of Mathematical Analysis and Applications, vol 158, no 1, pp 106–113, 1991 20 Th M Rassias, “On the stability of functional equations in Banach spaces,” Journal of Mathematical Analysis and ... “Classes of transformations and bordering transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223 –237, 1951 P G˘avrut a, A generalization of the Hyers-Ulam-Rassias stability ... functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, pp 222 224 , 1941 T Aoki, “On the stability of the linear transformation in Banach spaces,”...
10 296 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

Ngày tải lên : 03/04/2013, 21:07
... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... portion of the sample A 2–3 break between samples is enforced, as well as palate rinsing with filtered water, and unsalted crackers The amount of time required to evaluate each sample averaged 2–...
10 781 3
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Ngày tải lên : 05/09/2013, 16:11
... inclined at an angle equal to latitude of Chennai (13o) facing towards due south for the maximum year round performance Each evaporator and condenser tray has an area of 1m2 inclined at an angle of ... temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged over the day ... variation of global solar radiation and ambient temperature at Chennai for January to June _ Solar radiation -Ambient temperature Figure Mean monthly hourly variation of global solar radiation...
26 568 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Ngày tải lên : 28/10/2013, 11:15
... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... and biodiversity are most threatened values  Amount of commercial shipping and number of trading partners affecting pathway strength  A limited number of IMP have been identified in APEC Management...
10 583 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
11 873 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Ngày tải lên : 05/03/2014, 14:20
... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 ... and resolution and many advantages for studying Raman and Fluorescence spectra We succeeded in obtaining Raman spectra of petrol extracts by 30mW He-Ne laser excitation The high sensitivity of ... He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser excitation Acknowledgements: This work is supported by the Natural...
6 524 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Ngày tải lên : 14/03/2014, 13:20
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... close to the real area has to be greater than that afar Fig 21 The 3D computational domain surrounding a real 3D topography 104 D.N Hai, N.T Thang / VNU Journal of Science, Mathematics - Physics...
14 402 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Ngày tải lên : 15/03/2014, 00:20
... pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra were representative of at least three ... PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were infiltrated into the same leaves of tobacco plants, which had been sprayed ... 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast expression consensus sequence (including ATG) must...
15 479 0
Development of a simple

Development of a simple

Ngày tải lên : 15/03/2014, 23:56
... Analytica Chimica Acta for the awarded bursary to present a paper at Euroanalysis X (Basel, Switzerland) The authors thank the crew of the R/V Belgica for their assistance during sampling, and Prof ... using a HDPE scrapper Air was expelled and the bag was resealed and then stored at 48C for transport to the laboratory In the laboratory, the particulate material was immediately air dried at 458C ... al / Analytica Chimica Acta 392 (1999) 3±17 Table Procedures used for particle extraction experiments using particulate material from Halton Quay with EDTA, HCl, ammonium acetate and acetic acid...
15 410 0

Xem thêm