Characterisation of CD137 as a neoantigen on cancer cells
... as well as signaling via CD137 into the cancer cells may potentially be responsible for conferring a survival advantage upon cancer cells As a result, increased T cell apoptosis (Schwarz et al ... it was hypothesized that cancer cells may express CD137 as a neo-antigen to gain certain survival advantages Due to the bidirectional nature of CD137: CD137L signali...
Ngày tải lên: 03/10/2015, 11:37
... Distant metastasis Presence of distant metastasis cannot be assessed No distant metastasis Distant metastasis Table 1.1 TNM staging classification of gastric cancer 11 1.2.2 Metastasis Is a Multi-Step ... Hou Q, Tan HT, Lim KH, Lim TK, Khoo A, Tan IB, Yeoh KG, Chung MC Identification and Functional Validation of Caldesmon as a Potential Gastric Cancer...
Ngày tải lên: 10/09/2015, 09:09
... orientation in the Construction of cell clones Metabolic labelling and carbohydrate analysis BxPC3 cells and T5AS clone (4.0 · 106 cells) were plated in 25-mm2 flasks containing 0.2 mCi [3H]Gal (Amersham ... as are the original BxPC3 cells (Fig 2C) A relevant amount Fig Characterization of T5AS clone A cell clone expressing a b3Gal-T5 antisense construct (T5AS) was obt...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo y học: " Cyanide intoxication as part of smoke inhalation a review on diagnosis and treatment from the emergency perspective" pps
... (Phila) 2006, 44(Suppl 1):37-44 Page of doi:10.1186/1757-7241-19-14 Cite this article as: Lawson-Smith et al.: Cyanide intoxication as part of smoke inhalation - a review on diagnosis and treatment ... detect and measure CN in blood are usually not readily available and that patients may often be exposed to both CO and CN, clinicians have to rely on the...
Ngày tải lên: 13/08/2014, 23:20
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY
... IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY The DNA Base Excision Repair (BER) pathway repairs DNA damaged by endogenous and exogenous ... times and the long distances Thanks for always being there for me and for being my number #1 fan v ABSTRACT Aditi Ajit Bapat INHIBITION OF AP...
Ngày tải lên: 24/08/2014, 13:10
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient
... bilateral ovarian mature teratoma, using both biochemical and histological techniques The Patient Clinical Findings An eight- year- old female presented with a three-week history of abdominal swelling ... high amounts of mucin- like amino acids, serine, threonine and proline Serine and threonine are points of O-glycosylation found in the tandem repeat regions of mucin...
Ngày tải lên: 26/10/2012, 10:03
A contrastive analysis of encouraging as a speech act in english and vietnamese
... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... Objectives of The Study This research is intended to deal with the followings: - To find out the common strategies of encouraging in Vietnamese as...
Ngày tải lên: 26/11/2013, 13:31
Tài liệu The Man of Letters as a Man of Business docx
... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... chance To plan a surprise of it, to aim a book at the public favor, is the most hopeless of all endeavors, as it is one of the unworthie...
Ngày tải lên: 17/02/2014, 19:20
Tài liệu Test of English as a Foreign Language doc
... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malays...
Ngày tải lên: 20/02/2014, 11:21
Tài liệu flight of the flamingos a study on the mobility of r d workers docx
Ngày tải lên: 23/02/2014, 04:20
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling cascade that couples activated receptors with the activation of initiator caspase-8 ... triggering induces membrane proximal signals to induce nuclear export of FADD that are independent of CD95 internalization and ‘classic’ apoptotic signaling events, such as D...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protec...
Ngày tải lên: 07/03/2014, 15:20
TEST OF ENGLISH AS A FOREIGN LANGUAGE TOEFL PRACTICE TESTS doc
Ngày tải lên: 08/03/2014, 20:20
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... appeared By comparison with the spectrum of N1-liganded GABARAP (A) , these resonance signals can be attributed to N1-liganded GABARAP By binding to GABARAP, N1 peptide displaces CRT from GABARAP A few ... A dissociation constant of 64 nm for the GABARAP CRT interaction was Calreticulin is a high affinity ligand for GABARAP Fig Homology model of CRT(1–332) with...
Ngày tải lên: 16/03/2014, 05:20
Animal waste utilization effective use of manure as a soil resource
... neither waste nor asset (Dittrich, 1993) Manure was largely viewed as a farm asset up until the early 1960s At that time the theme of manure as a waste, as something to be disposed of, began to ... valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfal...
Ngày tải lên: 16/03/2014, 11:44