THE ROLE OF ANNEXIN 1 IN THE REGULATION OF INFLAMMATORY STRESS RESPONSE IN MACROPHAGES

... 11 6 11 9 4 .1 The role of Annexin- 1 in the regulation of inflammatory stress 11 9 response 4.2 Conclusion 14 4 4.3 Limitations of the study 14 5 4.4 Future work 14 6 Bibliography 14 8 Summary Annexin- 1 ... for investigation of the basis of the inflammatory stress response The aims of this study are thus, 1) To determine the role of ANXA1 in the regulation of the inflammatory response upon induction ... (ANXA1) 27 1. 6 .1 Functions of ANXA1 29 1. 6 .1. 1 ANXA1 in inflammation 29 1. 6 .1. 2 ANXA1 in cellular proliferation, differentiation and apoptosis 31 1.6 .1. 3 ANXA1 in cancer 33 1. 6 .1. 4 ANXA1 in leukocyte...

The role of sentence stress in enhancing english speaking competence of HPU english majors

... for my study The role of sentence stress in enhancing English speaking competence of HPU English majors A survey within the scope of the study is conducted at HPU The major aim of the study is ... clear to you The role of sentence stress in enhancing English speaking competence Sentence stress is the governing stress in connected speech All words have their individual stress in isolation ... intonation along with the relationship between sentence stress and speaking competence  Raising English majors awareness of the existence of the sentence stress and the effective using in enhancing...

CHARACTERIZING ROLES OF ANNEXIN 1 IN BREAST CANCER DEVELOPMENT BY MASS SPECTROMETRY BASED QUANTITATIVE PROTEOMICS

... tagging for relative and absolute quantification IAA Iodoacetamide ICAT Isotope-coded affinity tagging K0R0 12 C 614 N2-lysine and 12 C 614 N4-arginine K8R10 13 C 615 N2-lysine and 13 C 615 N4-arginine ... Annexin 1. 2 .1: Structure of ANXA1 ANXA1 is one of the members of the annexin superfamily of 13 members (A1-A13) All members of this superfamily have the same principal property of binding to negatively-charged ... System, Singapore on 30 January 2 013 This work was presented as a poster in Proteomics Forum held in Berlin, Germany from 17 – 21 March 2 013 xvii Chapter 1: Introduction 1. 1: Breast cancer Breast cancer...

Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx

... FEBS 5277 Nectin -1 mediates HSV -1 entry into RPE cells V Tiwari et al Fig Role of nectin -1 during HSV -1 entry into RPE cells (A) Antibody against nectin -1 signiﬁcantly inhibits HSV -1 entry into cultured ... stained CHO-HVEM RPE D Events B 11 4 A C 10 1 10 2 11 9 10 0 10 3 10 4 FITC stained CHO -nectin -1 Events RPE 10 0 10 1 10 2 FITC 10 3 10 4 Fig Expression of HSV -1 gD receptors in RPE cells (A) RT-PCR analysis of ... be important for HSV -1 entry into RPE cells Nectin -1 acts as the major receptor for HSV -1 entry into RPE cells To determine which receptors were important for HSV -1 entry into RPE cells, previously...

A metabolomics approach to understand mechanism of heat stress response in rat

... triiodothyronine (T3) and thyroxine (T4) and the activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), creatine kinase (CK) and lactate dehydrogenase ... unrestrained heat- acclimated rats Measurement of these variables without the confounding effects of restraint or handling has increased the validity of the rat as a model for human heat acclimation ... understanding of heat stress mechanism and metabolism in rat can eventually help in better management of heat related disorders Studies have already shown that pretreatment with anti-inflammatory...

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... requires protein translocation to the nucleus Although functional analyses of individual domains have not been addressed, the global context of the domain analyses allows us to draw a more general ... 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... constitute the minimal transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain...

Báo cáo khoa học: Alternative initiation of transcription of the humanpresenilin 1gene in SH-SY5Y and SK-N-SH cells The role of Ets factors in the regulation ofpresenilin 1 pptx

... m wt )11 9/ +17 8 )11 9/ +14 3 )22/ +17 8 )22/+4 10 0 73 91 23 21 ± 10 ± 3.4 ± 2.6 10 0 13 3 10 0 15 0 ± ± ± ± 12 10 10 m ± ± ± ± 30 20 20 70 70 28 ± ± ± ± 20 not examined which sequences in the )11 8/)35 ... site(s) (A) Eﬀect of point mutations in Ets and Sp1 motifs on PS1 promoter activity The positions of Ets (d) and Sp1 (h) motifs in the )11 9/ +17 8 region of the PS1 promoter are indicated The positions ... using the concentration of protein in the extract as an internal standard The activity of ( )11 9/ +17 8) PS1CAT in the presence of the empty vector was taken as 10 0% The values represented in the...

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... Colosia AD, Donahue JP, Lin YZ, Hawiger J: Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization ... stress-activated protein kinases, also called cJun NH2-terminal kinases (JNKs); and the p38 MAPKs [13] The JNK pathway is of interest because of its capacity to phosphorylate the amino acids serine-63 ... protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense...

Báo cáo y học: "Science review: Redox and oxygen-sensitive transcription factors in the regulation of oxidant-mediated lung injury: α role for hypoxia-inducible factor-1α" pptx

... required for the expression of many cytokines involved in the pathogenesis of acute lung injury [26–35] In acute lung injury caused by infection of bacteria, cytokine receptors HIF-1 consists of two ... function play a central role in initiating the innate immune system and in activating NF-κB Anti-inflammatory cytokines have the ability to suppress inflammatory processes via the inhibition of NF-κB, ... Altogether, the data suggest a complex type of involvement of RTP801 in the pathogenesis of ischemic diseases 52 A hypothetical schematic depicting the role of HIF-1 in lung injury is displayed in...

Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation

... over-expression of p21WAF1 inhibits DNMT1 73 3 .1. 1.7 TSA -mediated induction of p21WAF1 results in inhibition of 76 DNMT1 3 .1. 1.8 TSA -mediated induction of p21WAF1 is independent of p53 85 3 .1. 2 Transcriptional ... between DNMT1 and p21WAF1 in the 63 cell cycle 3 .1. 1 .1 3 .1. 1.2 DNMT1 expression in the cell cycle 63 WAF1 in DNA 67 p21WAF1 68 Transient over-expression of DNMT1 does not inhibit 71 Inverse relationship ... methylase 17 1. 3.3b DNMT1 interacts with Polycomb Group (PcG) proteins 17 1. 3.3c DNMT1 interacts with UHRF1 18 Transcriptional suppression 19 1. 3.4 iv 1. 4 DNMT1 in the Cell Cycle 1. 4 .1 21 1.4.2 E2F1/RB...

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... conﬁrmed by Lin-54 binding to the CHR, cooperating with E2F4 binding to the CDE in EMSAs in vitro [86] ChIP experiments on the Cdc2 gene also provided insights into the association of other cell cycle ... proteins with the promoter E2F4 binding during the cell cycle coincides with the binding of p107 or p130 [61,85] Another E2F site distal to the E2F ⁄ CDE acts as an activating element binding ... responsible for cell cycle-dependent expression of the gene Surprisingly, deregulation of the promoter does not lead to loss of its activity but causes activation in resting cells and in G1 cells Therefore,...

Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt

... were maintained in a hypoxia chamber (Invivo 400; Ruskinn Inc., Cincinnati, OH, USA) constantly maintained at 1% O2 Culture medium was replaced every other day inside the chamber For miRNA transfection, ... were treated as described in (A) Total RNA was prepared at the indicated times and subjected to quantitative real-time PCR analysis The data shown are mean value ± standard errors of the mean from ... incubator with 21% O2 The normoxia data are the same as shown in Fig and are included here for comparison Expression of miR-2 7a and miR-27b at the indicated time points was assessed by quantitative...

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

... evaluation of heme dynamics in cultured cells Role of heme metabolism in cellular heme content Regulatory role of free heme in expression of HO-1 To evaluate the contribution of heme synthesis and ... HO-1 protein was also induced by the treatment with HO-2 siRNA in HepG2 cells These results indicate that the down-regulation of HO-2 expression is associated with induction of HO-1 expression ... protein, in comparison with the low expression of HO-1 protein, in H146 small cell lung cancer cells is of particular interest because small cell lung cancer is derived from the airway neuroepithelial...

Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafﬁcking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efﬁcient GABA-uptake activity of the GABA transporter pptx

... side-chains are important for the GABA transport activity 1- Deoxymannojirimycin inhibits the GABA- uptake of GAT1 In order to gain further insight into the role of the terminal structures of the N-glycans ... N-glycans, in particular their terminal structures, are involved in regulating the GABA translocation of GAT1, but not in binding of GAT1 to GABA Transport of GABA by GAT1 across the cell membrane ... trimming of their N-oligosaccharides strongly affected their GABAuptake activity These indicate that the terminal structure of the oligosaccharides facilitate efﬁcient GABA- uptake activity of the...

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

... raise the possibility that GSK3 may help to coordinate increases in glucose uptake and glycogen synthesis allowing for more effective ÔchannellingÕ of glucose into glycogen in response to insulin ... Effects of insulin, Li and SB-415286 on signalling elements implicated in the regulation of GSK3 and GS To further understand the effects of Li and SB-415286 on cell signalling events we assessed their ... by insulin Regulation of GS activity To establish the importance of GSK3 inhibition on GS activity we monitored the effects of insulin, Li, SB-415286 and wortmannin (a PI3K inhibitor) on the incorporation...

Xem thêm