Characterization of high efficiency pseudo bilayer organic solar cells and

... SILICON SOLAR CELLS    17   AMORPHOUS SILICON SOLAR CELLS    19   DYE SENSITIZED SOLAR CELLS    21   PEROVSKITE SOLAR CELLS    23   ORGANIC SOLAR CELLS ... recent technologies that have shown a lot of potential such as dye sensitized solar cells, perovskite solar cells and organic solar cells There is a lot of research that is being carried out on .....

Ngày tải lên: 30/09/2015, 10:11

... manufacturing Analysis and performance The principle of operation of reluctance synchronous machines (RSMs) is based on existence of variable reluctance in the air gap of the machine, high reluctance ... P.J and Agu, L.A Theory and Performance of Polyphase Reluctance Machines Proc IEE, 111(8), pp 1435-1445, 1964 [2] Lawrenson, P.J and Gupta, S.K Develop...

Ngày tải lên: 05/09/2013, 16:30

... The nanosheet structure after calcinations was destroyed and changed to nanorods/nanoparticles composite at high temperature [27,30] Conclusions In summary, high surface area nanosheet TiO2 with ... diameter and about 5–10 nm in particles diameter, Fig 6(a–f)) The SEM, TEM, and SAED images of the nanosheet TiO2 calcined at 600 and 700 °C showed almost nanoparticles...

Ngày tải lên: 20/03/2014, 13:06

... Al concentrations in a solution of 0.025 M zinc nitrate [Zn(NO3)2·6H2O] and hexamethylenetetramine (HMT), we obtained ultrathin flake-like AZO nanostructures of high s and distinct morphology Moreover, ... 0.337, and a PCE of 1.04% With doping and mM Al concentrations, the J SC of devices increases to 10.26 and 11.08 mA cm -2 , and the PCE increases to 1.26% and 1....

Ngày tải lên: 20/06/2014, 22:20

... al.: Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B Journal of Immune Based Therapies and Vaccines 2010 8:9 Submit your ... HuMAbs neutralize SEB-induced cytokine production by human lymphocytes To examine the biological activity of HuMAbs in vitro, a cell-based assay was employed t...

Ngày tải lên: 11/08/2014, 08:21

... applications and challenges with bifacial solar cells and modules 10 Background 10 2.1.1 Bifacial solar cells and module structures 10 2.1.2 History of bifacial solar cells and modules ... solar cells and modules This thesis focuses on characterisation and standardisation of bifacial solar cells and modules, and on performance evaluatio...

Ngày tải lên: 09/09/2015, 08:13

... structure for memory application Results of the present study may enhance our understanding of the application of organic and polymer materials to the organic memory device and it may also contribute ... observed from a lot of organic/ polymer materials based device since 1960s, none of the devices based on these materials can fulfill all the requireme...

Ngày tải lên: 12/09/2015, 11:29

... the high- k material in consideration EOT is given by tox  thigh  k  kSiO2 / khigh  k , where thigh  k and khigh  k are the physical thickness and relative dielectric constant of high- k dielectric, ... density Jg Gate leakage current density k Dielectric constant (relative permittivity) kGe Dielectric constant of Ge (relative permittivity) khigh -k Di...

Ngày tải lên: 14/09/2015, 08:25

... retention performance of nanocrystal memory through the use of high dielectric constant tunnel barriers and trap engineering By using a crested barrier structure as the tunnel barrier, a high electric ... xiv List of Tables Table 4-1: Comparison of the |Vprog/Vret| ratio of MIS structures with Al gate and Si substrate using (a) crested tunnel barriers and (b)...

Ngày tải lên: 16/09/2015, 15:53

... number of Arabidopsis transcripts are potential targets for regulation by the PUF family of proteins The results obtained reveal a molecular conservation of PUF proteins in Arabidopsis thaliana and ... regarding the binding specificity of the subset of group I APUM proteins, showing that A thaliana has at least six PUF proteins with conserved RNA -binding...

Ngày tải lên: 18/02/2014, 06:20

... 1 H NMR of mobile lipids in tumour cells A M Luciani et al MCF-7 cells from human cancers In a previous study [13], we demonstrated that these cells display intensity modulation of ML signals ... provided in Fig 1B (insert), which shows the characteristic cross peak from the geminal protons of carbons and of glycerol in TG [1] Cross peaks of lipids, includ...

Ngày tải lên: 18/02/2014, 13:20

... orthologs of the type I isomerase Highest degrees of similarity were found to Idi-1 proteins of the c-proteobacteria A vinelandii and P luminescens and to Idi-1 protein of the Bacteroid C hutchinsonii ... Halobacterium sp NRC-1, Mycobacterium marinum and Photorhabdus luminescens featuring both a putative idi-1 and a putative idi-2 gene, the distribution of type I and...

Ngày tải lên: 19/02/2014, 13:20

... mgÆmL)1 BSA and stored at )20 °C Electrogenic BSP uptake inhibition by antibodies The kinetics of bilitranslocase transport activity inhibition by antibodies were examined by preincubating 24 lL ... addition of protein (2.6 ± 0.04 lmolÆmin)1Æmg protein)1, with lg valinomycin), as well as of K+ (6.25 ± 0.16 unitsÆmEq)1 K+, with lg valinomycin) and valinomycin (0.5...

Ngày tải lên: 20/02/2014, 01:20

... 1102 USP7- FL USP7 1-560 USP7 208-560 USP7 208-1102 EGFP USP7 1-205-EGFP EGFP USP7 20-205-EGFP EGFP USP7 50-205-EGFP EGFP USP7 70-205-EGFP Fig Structural functional features and constructs of USP7 ... Fernandez-Montalvan et al Biochemical characterization of USP7 Fig Enzymatic characterization of USP7 (A) Progress curves for the USP7- catalyzed hydrolysi...

Ngày tải lên: 07/03/2014, 05:20

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên: 07/03/2014, 16:20