Characterization of high efficiency pseudo bilayer organic s

Characterization of high efficiency pseudo bilayer organic solar cells and

... SILICON SOLAR CELLS 17 AMORPHOUS SILICON SOLAR CELLS 19 DYE SENSITIZED SOLAR CELLS 21 PEROVSKITE SOLAR CELLS 23 ORGANIC SOLAR CELLS ... recent technologies that have shown a lot of potential such as dye sensitized solar cells, perovskite solar cells and organic solar cells There is a lot of research that is being carried out on .....

Ngày tải lên : 30/09/2015, 10:11

104
279
0

Analysis and performance of high efficiency synchronous reluctance machines

... manufacturing Analysis and performance The principle of operation of reluctance synchronous machines (RSMs) is based on existence of variable reluctance in the air gap of the machine, high reluctance ... P.J and Agu, L.A Theory and Performance of Polyphase Reluctance Machines Proc IEE, 111(8), pp 1435-1445, 1964 [2] Lawrenson, P.J and Gupta, S.K Develop...

Ngày tải lên : 05/09/2013, 16:30

8
626
0

preparation and characterization of high surface area nanosheet titania with mesoporous structure

... The nanosheet structure after calcinations was destroyed and changed to nanorods/nanoparticles composite at high temperature [27,30] Conclusions In summary, high surface area nanosheet TiO2 with ... diameter and about 5–10 nm in particles diameter, Fig 6(a–f)) The SEM, TEM, and SAED images of the nanosheet TiO2 calcined at 600 and 700 °C showed almost nanoparticles...

Ngày tải lên : 20/03/2014, 13:06

5
462
0

Báo cáo hóa học: " Controllable synthesis of flake-like Al-doped ZnO nanostructures and its application in inverted organic solar cells" doc

... Al concentrations in a solution of 0.025 M zinc nitrate [Zn(NO3)2·6H2O] and hexamethylenetetramine (HMT), we obtained ultrathin flake-like AZO nanostructures of high s and distinct morphology Moreover, ... 0.337, and a PCE of 1.04% With doping and mM Al concentrations, the J SC of devices increases to 10.26 and 11.08 mA cm -2 , and the PCE increases to 1.26% and 1....

Ngày tải lên : 20/06/2014, 22:20

6
488
0

Báo cáo y học: " Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B" ppsx

... al.: Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B Journal of Immune Based Therapies and Vaccines 2010 8:9 Submit your ... HuMAbs neutralize SEB-induced cytokine production by human lymphocytes To examine the biological activity of HuMAbs in vitro, a cell-based assay was employed t...

Ngày tải lên : 11/08/2014, 08:21

9
392
0

Characterization and performance analysis of bifacial solar cells and modules

... applications and challenges with bifacial solar cells and modules 10 Background 10 2.1.1 Bifacial solar cells and module structures 10 2.1.2 History of bifacial solar cells and modules ... solar cells and modules This thesis focuses on characterisation and standardisation of bifacial solar cells and modules, and on performance evaluatio...

Ngày tải lên : 09/09/2015, 08:13

179
945
0

Fabrication and characterization of memory devices based on organic polymer materials

... structure for memory application Results of the present study may enhance our understanding of the application of organic and polymer materials to the organic memory device and it may also contribute ... observed from a lot of organic/ polymer materials based device since 1960s, none of the devices based on these materials can fulfill all the requireme...

Ngày tải lên : 12/09/2015, 11:29

132
434
0

Development and characterization of high k dielectric germanium gate stack

... the high- k material in consideration EOT is given by tox  thigh  k  kSiO2 / khigh  k , where thigh  k and khigh  k are the physical thickness and relative dielectric constant of high- k dielectric, ... density Jg Gate leakage current density k Dielectric constant (relative permittivity) kGe Dielectric constant of Ge (relative permittivity) khigh -k Di...

Ngày tải lên : 14/09/2015, 08:25

159
578
0

Modeling and characterization of high dielectric constant tunnel barriers for nanoelectronic applications

... retention performance of nanocrystal memory through the use of high dielectric constant tunnel barriers and trap engineering By using a crested barrier structure as the tunnel barrier, a high electric ... xiv List of Tables Table 4-1: Comparison of the |Vprog/Vret| ratio of MIS structures with Al gate and Si substrate using (a) crested tunnel barriers and (b)...

Ngày tải lên : 16/09/2015, 15:53

251
318
0

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... number of Arabidopsis transcripts are potential targets for regulation by the PUF family of proteins The results obtained reveal a molecular conservation of PUF proteins in Arabidopsis thaliana and ... regarding the binding speciﬁcity of the subset of group I APUM proteins, showing that A thaliana has at least six PUF proteins with conserved RNA -binding...

Ngày tải lên : 18/02/2014, 06:20

15
586
0

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... 1 H NMR of mobile lipids in tumour cells A M Luciani et al MCF-7 cells from human cancers In a previous study [13], we demonstrated that these cells display intensity modulation of ML signals ... provided in Fig 1B (insert), which shows the characteristic cross peak from the geminal protons of carbons and of glycerol in TG [1] Cross peaks of lipids, includ...

Ngày tải lên : 18/02/2014, 13:20

14
765
0

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... orthologs of the type I isomerase Highest degrees of similarity were found to Idi-1 proteins of the c-proteobacteria A vinelandii and P luminescens and to Idi-1 protein of the Bacteroid C hutchinsonii ... Halobacterium sp NRC-1, Mycobacterium marinum and Photorhabdus luminescens featuring both a putative idi-1 and a putative idi-2 gene, the distribution of type I and...

Ngày tải lên : 19/02/2014, 13:20

12
692
0

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

... mgÆmL)1 BSA and stored at )20 °C Electrogenic BSP uptake inhibition by antibodies The kinetics of bilitranslocase transport activity inhibition by antibodies were examined by preincubating 24 lL ... addition of protein (2.6 ± 0.04 lmolÆmin)1Æmg protein)1, with lg valinomycin), as well as of K+ (6.25 ± 0.16 unitsÆmEq)1 K+, with lg valinomycin) and valinomycin (0.5...

Ngày tải lên : 20/02/2014, 01:20

15
589
0

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modiﬁcation sites and structural requirements for substrate processing and subcellular localization pptx

... 1102 USP7- FL USP7 1-560 USP7 208-560 USP7 208-1102 EGFP USP7 1-205-EGFP EGFP USP7 20-205-EGFP EGFP USP7 50-205-EGFP EGFP USP7 70-205-EGFP Fig Structural functional features and constructs of USP7 ... Fernandez-Montalvan et al Biochemical characterization of USP7 Fig Enzymatic characterization of USP7 (A) Progress curves for the USP7- catalyzed hydrolysi...

Ngày tải lên : 07/03/2014, 05:20

15
592
0

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên : 07/03/2014, 16:20

12
772
0