Toward synthesis of a macrocyclic hybrid aromatic pentamer

... TOWARD SYNTHESIS OF A MACROCYCLIC HYBRID AROMATIC PENTAMER SUN XIAONAN (M.Sc.) PKU A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF CHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE ... synthetic facility, high structural diversity and adaptability In this regard, the aim of this study was to design and synthesize a new class of cyclic pentamer w...

Ngày tải lên: 30/09/2015, 10:11

... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase ... The DNA fragment coding the scFvLH (10 pg) was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LAT...

Ngày tải lên: 16/03/2014, 23:20

... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 18 0°C ... water and absolute ethanol respectively, and finally dried in air at 60°C The XRD pattern of prepared powder sample was collected using a Rigaku D/ Max-2200PC X-ray diffractom...

Ngày tải lên: 19/03/2014, 16:48

... Srivastava, A K; Nandedkar, R V Growth and characterization of alpha-Fe2O3 nanowires J Appl Phys 2007, 102, 054303 [14] Dong, W T.; Zhu, C S Use of ethylene oxide in the sol gel synthesis of alpha-Fe2O3 ... Material (ESM) In spite of intensive research into one-dimensional structures of metal oxides in particular and NWs in general, our understanding of the mechanisms of...

Ngày tải lên: 20/03/2014, 13:07

... enantioselective Strecker reactions and analogous syntheses Chem Rev 103:2795–2827 doi:10.1021/cr020038p Arasappan A, Venkatraman S, Padilla AI, Wu W, Meng T, Jin Y, Wong J, Prongay A, Girijavallabhan V, ... GKS, Mathew T, Panja C, Alconcel S, Vaghoo H, Do C, Olah GA (2007) Gallium (III) triflate catalyzed efficient Strecker reaction of ketones and their fluorinated analogs Proc Nat A...

Ngày tải lên: 20/06/2014, 22:20

... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a C...

Ngày tải lên: 21/06/2014, 06:20

... with a mean annual rainfall and temperature of 1144 mm and 22 °C respectively The trial was located at an elevation of 45 m on an east facing slope Soil parent material is of aeolian origin and ... treatments for selected wood and pulping properties as well as between the groups of variates for each treatment A summary of the analysis of variance and tr...

Ngày tải lên: 08/08/2014, 01:21

... than three years To investigate the genetic mechanisms that are involved in establishing and maintaining resistance to TA, we have performed a global transcriptional analysis in TAhabituated cells ... compared to a very faint staining in control cells, also suggesting the accumulation of more pectins in the cell walls of TA(-)hab cells (Additional file Fig S3) Hab...

Ngày tải lên: 11/08/2014, 11:21

... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...

Ngày tải lên: 12/02/2014, 10:20

... Authority Atlanta, Georgia Metro-Dade Transit Agency Miami, Florida San Francisco Bay Area Rapid Transit District Oakland, California Metra (Metropolitan Rail) Chicago, Illinois MTA New York City Transit ... sophisticated applications in at least one of the four management and operational areas under consideration (i.e., administration, planning and operations, materials management...

Ngày tải lên: 18/02/2014, 11:20

... characterization of native a-conotoxins Analysis of neuronally active a-conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard procedures ... 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271) 2299 Fig LC/MS analysis of crude venom from C geographus Example of experime...

Ngày tải lên: 19/02/2014, 12:20

Ngày tải lên: 19/02/2014, 15:20

... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A,...

Ngày tải lên: 20/02/2014, 01:20

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its tar...

Ngày tải lên: 20/02/2014, 11:20

... confirming the adenylylation of these compounds and the absence of synthesis of poly(A) by the E coli poly(A) polymerase, we did not observed adenylylation of guanosine, GDP or Gp4G by the yeast enzyme ... independent synthesis of poly(A) In order to understand why dinucleoside polyphosphates activated the primer independent synthesis of poly...

Ngày tải lên: 21/02/2014, 01:21