a synthesis of hydrocarbons

... fully relational database management systems, with a GUI in place for the client function and assume an active process of ensuring that appropriate data are made available across management activities ... data • Prevent duplication of hardware/software • Provide maintenance and support for hardware/software • Provide user training Past Practices Organizational Barriers Organizational barriers appear ... sophisticated applications in at least one of the four management and operational areas under consideration (i.e., administration, planning and operations, materials management, and advanced technology...

Ngày tải lên: 18/02/2014, 11:20

... Indonesia ● ● ● Israel ● ● Kenya Korea ● Mexico ● ● ● ● Nicaragua ● ● ● Panama ● Pakistan Thailand ● ● Vietnam ● ● APEC Asia-Pacific Economic Co-operation ASEAN Association of Southeast Asian Nations ... Africa EAC East African Cooperation LAIA Latin American Integration Association MERCOSUR Southern Common Market NAFTA North American Free Trade Agreement SAPTA South Asian Preferential Trade Arrangement ... regional trade agreements Country APEC ASEAN CACM CAFTA-DR CEFTA COMESA EAC Chile ● ● ● ● China LAIA ● Brazil MERCOSUR NAFTA SAPTA ● ● ● Cuba ● Czech Republic ● Dominican Rep Guatemala ● ● Honduras...

Ngày tải lên: 07/03/2014, 08:20

... Rwanda, Senegal, South Africa, Sri Lanka, Tanzania, Togo, Uganda, Vietnam, Zambia and Zimbabwe – and mainly over cereals—maize, wheat, sorghum, millet and teff (see Tables and 3) Table Dataset ... DR Congo, El Salvador, Ethiopia, Ghana, Ghana, Guatemala, Honduras, India, Indonesia, Kazakhstan, Kenya, Malawi, Mexico, Morocco, Mozambique, Nepal, Niger, Nigeria, Pakistan, Paraguay, Peru, Philippines, ... Land Management Practices for Climate Change Mitigation and Adaptation in Sub-Saharan Africa Rome, Food and Agriculture Organization of the United Nations World-Bank 2006 Sustainable Land Management:...

Ngày tải lên: 17/03/2014, 15:20

... The Health Association of African Canadians In August 2001, the Black Women’s Health Network was legally registered as the Health Association of African Canadians (HAAC) The HAAC is a group of individuals ... services In January 2001, the Population and Public Health Branch of Health Canada (PPHB), Atlantic Region, awarded a grant to the Health Association of African Canadians (HAAC, formerly the Black Women’s ... Wen 2000 Canadian Perinatal Health Report Health Canada: Canadian Perinatal Health Surveillance System Atwell, Y 2001 Finding the Way: Establishing a dialogue with Rural African Canadian Communities...

Ngày tải lên: 22/03/2014, 10:20

... showing a net surface gain during a week period from data collected at Barrow, AK However, there are many limitations associated with calculating such a mass balance that the applicability of their ... the sum of aerodynamic resistance, quasi-laminar sub layer resistance and surface resistance RGM surface resistance characteristics are assumed to be similar to that of nitric acid because of their ... number of natural and anthropogenic sources Experimental field data and model estimates indicate that anthropogenic Hg emissions are at least as great as those from natural sources (Mason et al.,...

Ngày tải lên: 01/07/2014, 16:05

... Mass Methods Reference v v v m m m v v v p m m m a7 N /A a7 a3 /b4 (less active) (less active) a3 /b2, a7 a3 /b2, a7 a3 /b2, a7 a3 b2; a6 b2b3 a3 b2 /a3 b4; a7 a3 a7b4 /a3 a5b4 a3 b2 a a7 a a7 a a3b2 a3 b2 a6 b2b3 ... example, asparagine to aspartic acid, or glutamine to glutamic acid changes [14] The a- conotoxins EpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine residues [5,10,21,23,24] (Table ... characterization of native a- conotoxins Analysis of neuronally active a- conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard...

Ngày tải lên: 19/02/2014, 12:20

Ngày tải lên: 19/02/2014, 15:20

... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...

Ngày tải lên: 19/02/2014, 16:20

... alignment is retained so that each utterance is automatically labeled Once the entire corpus has been recorded, alignments are automatically refined based on specific individual voice characteristics ... creation of a database that will be used in speech synthesis, it can also be used as a digital audio recording tool for speech research For example, the MT Voice Recorder offers useful features ... feedback on the quality of each utterance they record in terms of pronunciation accuracy, relative uniformity of pitch, and relative uniformity of amplitude Conference attendees will be able...

Ngày tải lên: 20/02/2014, 09:20

... part (B) of the figure After 30, 60 and 120 incubation at 37 °C, aliquots were taken and analyzed by HPLC as indicated in Materials and methods Relative activity of GpnGs as effectors of the synthesis ... also stimulated the synthesis of poly (A) catalyzed by yeast poly (A) polymerase The relative activity of diadenosine polyphosphates as effectors of the poly (A) synthesis was assayed as in Fig 4, ... carried out in duplicate (lanes C) The reaction mixtures were treated further with alkaline phosphatase and (after inactivation of the phosphatase) with phosphodiesterase and analyzed by TLC as...

Ngày tải lên: 21/02/2014, 01:21

Ngày tải lên: 21/02/2014, 09:20

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and...

Ngày tải lên: 07/03/2014, 12:20

... GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast ... significant changes in the accumulation of psbA mRNA, as revealed by RNA-filter hybridization experiments (data not shown) This indicates the likelihood of a translational defect of D1 synthesis ... mutants because they lack variable fluorescence – a signature of the absence of PSII [15] – but have a low (instead of a high) fluorescence yield This unusual feature was attributed to a major change...

Ngày tải lên: 07/03/2014, 15:20

... inventory of all the languages comprises of 21 consonants We further assume that the consonants are arranged in their hierarchy of preference A language traverses the hierarchy of consonants and at ... that languages usually tend to have smaller consonant inventory size, y = Ax−α A random variable is said to have a β-distribution with parameters α > and β > if and only if its probability mass ... preferential attachment can be interpreted as the tendency of a language to choose a consonant that has been already chosen by a 131 not all of the first 21 consonants Therefore, the probability of the...

Ngày tải lên: 08/03/2014, 02:21

... center of the tube and the other end was near the tubeÕs downstream end), the tube was evacuated by a mechanical rotary pump to a base pressure of  10À2 Torr The furnace was heated at a rate of ... them have thinner diameters of 5–10 nm A high-magnification TEM image (Fig 1c) shows that the nanowires are remarkably clean and smooth, and there are no particles at its surface An SAED pattern ... image), which is the location of the wafer (indicated by a two-way arrow) It can be seen that the as-grown nanowires on the wafer display well-aligned nature and have length of up to several...

Ngày tải lên: 16/03/2014, 15:03

... the algorithm lations Its operation is based on the automatic association of basic algorithms with dictionary entries, the automatic specification of variables, and the automatic evaluation of ... Information enabling the automatic specification of each of these variables is present in the form of grammatical codes in the entries of the Harvard Automatic Dictionary The indicated action Br can ... specification of an admissible variable at a given text position is the truth value of the proposition Only variables that can be specified automatically are admissible; the automatic specification of variables...

Ngày tải lên: 16/03/2014, 19:20

... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase Preparation ... was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR kit (50 lL) The sequences underlined are ... was amplified on the pEU–scFvLH using SP6 primer (5¢-ATTTAGGTGACACTATAG-3¢) and anti-primer (5¢-ATGGCGCCAGCTGCAGGCTA-3¢, anti-stop codon in bold), and transcribed in the same way as above Translation...

Ngày tải lên: 16/03/2014, 23:20

... in SEM and TEM Micro-Raman measurements were performed on a Horiba Jobin Yvon LabRam IR system at a spatial resolution of ␮m Raman scattering was excited with the 633 nm line of a He–Ne laser with ... to be an important parameter that influences the tin oxide nanomaterial morphology At lower ratios we obtained only irregular nano/microparticles We observed that the aspect ratio of as-prepared ... straight nanowires have a rectangular cross-section The Raman spectra and XRD pattern demonstrate that the nanowires are single-crystalline tin oxide with rutile structure The shift of Raman peaks...

Ngày tải lên: 19/03/2014, 16:47

... 2006 J Am Chem Soc 128 5468 923 Kotsikau D, Ivanovskaya M, Orlik D and Falasconi M 2004 Sensor Actuat B101 199 Rumyantseva M et al 2006 Sensor Actuat B118 208 Sorescu M, Diamandescu L, Tarabasanu-Mihaila ... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 180°C for ... HRTEM image and the SAED pattern may also be indexed to hexagonal phase of α-Fe2O3 The observed lattice spacings of 0⋅370 and 0⋅269 nm correspond to the (012) and (104) planes of hexagonal α-Fe2O3,...

Ngày tải lên: 19/03/2014, 16:48

... body and heated at 180 ◦ C for days The product obtained was washed with ethanol, cyclohexene, water and finally with ethanol and dried at room temperature The importance of citric acid as a structural ... images and SAED diffraction patterns of a WO3 nanorod The lattice parameters of 0.38 and 0.63 nm correspond to the d-spacings of (001) and (100) of the WO3 hexagonal cell H .A Therese et al / Solid ... nanorods to WS2 nanotubes An alumina crucible containing WO3 nanorods was placed in a tubular furnace and heated up to 840 ◦ C in Ar gas flow, then switched to H2 S gas for 30 at 840 ◦ C to allow...

Ngày tải lên: 19/03/2014, 16:48