Early stages of host invasion by pseudomonas aeruginosa and effect of cyclic diguanylate signaling
... in early stages of bacterial invasion, this study aimed to focus on the effect of MorA signaling on these factors The specific aims of this study were i) To understand the role of MorA in P aeruginosa ... attachment to host surface via surface appendages and subsequent entry into host cell ii) To study the effect of MorA-c-di-GMP signaling on P aeruginosa secr...
Ngày tải lên: 30/09/2015, 06:36
... presented only in terms of the additional effect of the HIV-specific antibodies All High-level enhancement of early patient isolates by early autologous sera The primary focus of this study was to ... Willey et al Retrovirology 2011, 8:16 http://www.retrovirology.com/content/8/1/16 Table Patient primary virus isolates Page of 20 Table Neutralisation of early patient...
Ngày tải lên: 13/08/2014, 01:20
... more critical for early stages in protein translocation in B subtilis than in E coli Results Changing the hydrophobicity of the AmyQ signal peptide To study the effects of signal peptide hydrophobicity ... Secretory protein targeting in Bacillus subtilis B subtilis is not responsible for the lack of export of AmyQ containing the Ala signal pept...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo lâm nghiệp: "Correlative control of early stages of flower bud initiation in ’bourse’ shoots of apple (Malus x domestica Borkh. cv. Golden Deliciou" docx
... completion of floral initiation (Fig 3, bottom) However, when applied too early, pruning made the uppermost buds break out immediately as leafy shoots Depending upon the insertion level of the bud, ... b, c; Abbott, 1977) Terminal buds of spurs and terminal and lateral buds on long shoots, intact or pruned, were considered separately (Fig 3, top) and, together with ringing and fr...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo y học: "Early rheumatoid arthritis is characterized by a distinct and transient synovial fluid cytokine profile of T cell and stromal cell origin" pptx
... nonsteroidal antirheumatic drug; RA, rheumatoid arthritis; RF, rheumatoid factor Results Patient characteristics Baseline characteristics of patients with early inflammatory arthritis of non-crystal origin ... patients with early inflammatory arthritis who groups develop rheumatoid arthritis (RA) from (a, b) all other early inflammatory arthritis patients (early disease tha...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Gene expression profile and synovial microcirculation at early stages of collagen-induced arthritis" pot
... considered statistically significant Results Gene expression profile in joints at onset of arthritis To define the gene expression profile at early stages of CIA, we used the murine Affymetrix oligonucleotide ... in normal synovium; = perivascular leucocyte infiltration, two or more synovial cell layers; = dense infiltration of leucocytes, synovial hyperplasia; = syn...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: " Open Access The association between bullying and early stages of suicidal ideation in late adolescents in Greece" pdf
... to test the association between bullying behavior and early stages of suicidal ideation in a sample of Greek adolescents and to examine whether this is independent of the presence of psychiatric ... disorders on the one hand and suicidal ideation and psychiatric disorders on the other [50] In our study we confirmed the confounding effect of...
Ngày tải lên: 11/08/2014, 16:23
Báo cáo y học: "Characterization of viroplasm formation during the early stages of rotavirus infection" ppsx
... are synthesized within viroplasms, which led to the hypothesis that the entering viral particles could serve as points of nucleation for the formation of viroplasms [8] In this work, the dynamics ... earlier stages of viroplasm formation, and in their work, following the expression of an NSP2 protein fused to EGFP in rotavirus SA-11 infected cells, they observed tha...
Ngày tải lên: 12/08/2014, 02:20
báo cáo khoa học: " Identification of microspore-active promoters that allow targeted manipulation of gene expression at early stages of microgametogenesis in Arabidopsis" pps
... identify promoters that allow the targeted manipulation of gene expression in microspores A number of male-gametophyte-specific promoters that are active at different developmental stages are ... decline in mature flowers, MSP2 and MSP3 initiate expression in microspores, but GUS expression peaks later and accumulates in mature pollen We also examined GUS...
Ngày tải lên: 12/08/2014, 05:20
báo cáo khoa học: " Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana" docx
... (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAA TGGCGGCGGATGCTCTGAG3' and 5'GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCAGCAACTTCTTCTTGAT CCTTG3') The expression clone was inserted into the donor vector pDONR201, and subsequently transformed ... through PCR amplification with the primer LBa-1 (located on the TDNA insert: 5'TGGTTCACGTAGTGGGCCATCG3') and primers flanking the predicted inserts (5'AAAAACAAAAGCAGACA...
Ngày tải lên: 12/08/2014, 05:20
Báo cáo y học: "Binding of protegrin-1 to Pseudomonas aeruginosa and Burkholderia cepacia" potx
... TSB, and 1% BSA Samples were layered over 0.3 ml of a cushion composed of parts of dibutyl phthalate and parts of di-isodecyl phthalate (density20 = 1.01) and centrifuged at approximately 14,000 ... of rabbit granulocyte peptides to Candida albicans with candidacidal activity Infect Immun 1985, 49:207-211 42 Tsomides T, Eisen H: Stoichiometric labeling of peptides by iodin...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo khoa học: Natriuretic peptides affect Pseudomonas aeruginosa and specifically modify lipopolysaccharide biosynthesis doc
... transduction of a signal mediated by natriuretic peptides, and a rapid and early effect of these peptides, we exposed the bacteria for a short time (30 min) to BNP and CNP and then determined their intracellular ... to natriuretic peptides This confirms the importance of cAMP in the mechanism of action of natriuretic peptides in P aeruginosa In this species, Vfr may be ac...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo y học: "Chronic pneumonia with Pseudomonas aeruginosa and impaired alveolar fluid clearance" docx
... conclusion, chronic P aeruginosa pneumonia is characterized initially at 48 hours by an increased alveolar- capillary barrier permeability and an adapted host response with an increased DAFC and LLC preserving ... beads; C-D: Pneumonia on the 2nd day (the arrow on panel D underlines infected beads); E-F: Pneumonia on the 5th day; G-H: Pneumonia on the 8th day; I-J: Pneumonia...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: " Assessment of pulmonary antibodies with induced sputum and bronchoalveolar lavage induced by nasal vaccination against Pseudomonas aeruginosa: a clinical phase I/II study" pot
... IgG and IgA antibodies in single fractions of bronchoalveolar lavage fluid (BALF, A and C) and induced sputum (IS, B and D) of n = 12 healthy volunteers vaccinated with nasal primary and a nasal ... healthy volunteers vaccifractions ofnasal primary and lavage fluidsystemicA and C) vaccinationline) and IgA antibodies of n = circles, dotted line) in...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: "Inhalation with Fucose and Galactose for Treatment of Pseudomonas Aeruginosa in Cystic Fibrosis Patients"
... fucose and galactose can prevent binding of PA lectins I and II (8, 15) In those studies inhibition of ciliary beats due to PA lectins was quantified as well as restoration by adding fucose and/ or ... National Hypertonic Saline in Cystic Fibrosis (NHSCF) Study Group A controlled trial of long-term inhaled hypertonic saline in patients with cystic fibrosis N E...
Ngày tải lên: 03/11/2012, 11:48