Development of surface activated granular media for effective adsorption and filtration
Development of surface activated granular media for effective adsorption and filtration
... being ineffective to the removal of suspended particles and dissolved substances It is therefore desirable to develop more effective granular media as both adsorption and filtration materials for ... experimental parts of coating PPy on the surfaces of glass beads and nylon 6,6 granules and immobilizing chitosan on the surfaces of PET and nylon 6,6 granules, as well as the adsorption and filtration ... stages) and deposition of colloid particles 2.3 Adsorption and Granular Filtration Separation processes like adsorption and filtration refer to the operations that transform a mixture of substances...
- 179
- 489
- 0
Development of intelligent unmanned aerial vehicles with effective sense and avoid capabilities
... density Lithium Polymer batteries and more efficient and compact actuators, thus resulting in the rapid development of unmanned aerial vehicles The vertical take-off and landing (VTOL) crafts due their ... creation of intelligent unmanned aerial vehicles, such as a sophisticated unmanned helicopter equipped with a vision enhanced navigation system [6], [7], [8] Utilizing the maneuvering capabilities of ... and development of the quadrotor platform The mechanical structure of the quadrotor platform will be introduced and the configuration of the rotor and propeller will be discussed Development of...
- 193
- 371
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified both by the quantitative ... abundance in activated sludge Nevertheless, quantitative PCR method for Candidatus ‘Accumulibacter phosphatis’ has not been developed yet In this study, quantitative PCR method for Candidatus ‘Accumulibacter...
- 7
- 719
- 0
Tài liệu DEVELOPMENT OF AN AUTOUMATIC DATA PROCESSING FOR TRIAXIAL COMPRESSION TEST pdf
... Triaxial Testing System, Advanced Triaxial Testing of Soil and Rock, American Society for Testing Materials - Special Technical Publication, ASTM STP 977, pp 82-94, (1988) [6] Miwa Koichi, Nanba ... Itsuo and Tsuneyoshi Akihiko, On the Real Time Processing System for Triaxial Compression Test of Soil, Bulletin of the Faculty of Agriculture, Kagoshima University, p.211-215, Japan, (1984) Trang ... application of the deviator stress This test is performed on undisturbed samples of cohesive soil, on reconstituted specimens of cohesionless soil and, in some instances, on undisturbed samples of cohesionless...
- 9
- 613
- 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... Ó FEBS 20 02 Photoactivatable CRF2 receptor antagonist (Eur J Biochem 26 9) 528 9 [21 ] and astressin [22 ], a conformationally constrained nonselective CRF peptide antagonist [ 12, 23], we were ... USA) was used to monitor radioactivity Photolysis of ATB-[His 12] Svg( 12) 40), and its radioactively labeled analog 125 I-labeled ATB-[His 12] Svg( 12) 40) Photolysis was performed at a wavelength of 360 ... characterization of a photoactivatable radioactively labeled CRF agonist and antagonists at CRF1 receptors, we were now interested in the development of a photoactivatable CRF2 -selective antagonist based on...
- 7
- 344
- 0
Báo cáo sinh học: " Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pdf
... RSV-A2 virus and stained with True Blue™ peroxidase substrate The image shows an example of plaque differentiation by automated counting Each "x" represents one plaque counted by the image analyzer ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutralizing antibody titers The 180 tests performed in the presence and absence of complement ... referencecounting methods and without Boxplots of RSV reference serum titers with and without complement separated by counting methods Open "o" represents manually counted titers and "* " represents...
- 5
- 420
- 0
báo cáo hóa học:" Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pptx
... presence and absence of complement and sorted the data by assay, method, and complement treatment The range and mean of the replicate tests are depicted in Fig The difference in the mean of 136 ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutralizing antibody titers The 180 tests performed in the presence and absence of complement ... level of agreement between the titers generated by image analysis and the standard plaque counting method By plotting the difference between titer values of each data pair against the mean of the...
- 5
- 322
- 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc
... Percentage Dose ( %) Figure DVH Comparison of ANFIS and manual planning for a prostate case DVH Comparison of ANFIS and manual planning for a prostate case rized overview of the differences of discrete ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a Another approach that has already ... vectors of original (manually created FIS) and trained FIS (ANFIS) for a given (identical) set of input vectors, thus providing an estimate of the "similarity" of the behaviour of the manually created...
- 16
- 510
- 0
Development of a liposomal nanodelivery system for nevirapine ppsx
... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery of didanosine for site ... myristate loaded liposomes J Pharmazie 2005, 60:840-843 37 Uma Maheswari K, Ramachandran T, Rajaji D: Interaction of cisplatin with planar model bilayers - Dose dependent change in electrical characteristics...
- 9
- 359
- 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis and ... Detection of the JAK2V617F mutation by asymmetric PCR and melt curve analysis Cancer Biomark 2007, 3:315-324 23 Rapado I, Albizua E, Ayala R, Hernández JA, Garcia-Alonso L, Grande S, Gallardo M, Gilsanz...
- 7
- 435
- 0
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx
... than descriptive form Templates are created specifically for a particular setting and can be filled in by the reporting physician Synoptic reports are of great value because they ensure that all ... enablers and barriers to the use and sustainability of clinical synoptic reports; and to provide any suggestions or recommendations for implementation and sustainability of the synoptic MRI report ... achieved and the extent of surgery that will be required to achieve this negative margin [7] To date, magnetic resonance imaging (MRI) is widely available and an accurate imaging modality for rectal...
- 6
- 440
- 0
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc
... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... implemented for rectal cancer in North America [16] Aims The specific aims of this project are to develop a synoptic MRI report for primary rectal cancer, and to elicit the opinions of radiologists regarding ... than descriptive form Templates are created specifically for a particular setting and can be filled in by the reporting physician Synoptic reports are of great value because they ensure that all...
- 6
- 351
- 0
development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ
... is an active method that may be used to directly evaluate the liquefaction resistance of soils in place The test is based on the premise of dynamically loading a native soil deposit in a manner ... me vi Development of a Direct Test Method for Dynamically Assessing the Liquefaction Resistance of Soils In Situ Publication No. _ Brady Ray Cox, Ph.D The University of Texas at Austin, 2006 ... Dynamically Assessing the Liquefaction Resistance of Soils In Situ by Brady Ray Cox, M.S Dissertation Presented to the Faculty of the Graduate School of The University of Texas at Austin in Partial Fulfillment...
- 542
- 309
- 0
Từ khóa: improvement for effective budgeting and financial reportingnurses perceptions of using a pocket pc for shift reports and patient careand there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly diseasethe discovery that micrornas mirnas are synthesized as hairpincontaining precursors and share many features has stimulated the development of several computational approaches for identifying new mirna genes in various animal speciesdevelopment of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestsarchitecture for the development of contextsensitive mobile applicationschuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ