Developing a 3d multi body simulation tool to study dynamic behaviour of human scoliosis

Developing a 3d multi body simulation tool to study dynamic behaviour of human scoliosis

Developing a 3d multi body simulation tool to study dynamic behaviour of human scoliosis

... DEVELOPING A 3D MULTI- BODY SIMULATION TOOL TO STUDY DYNAMIC BEHAVIOUR OF HUMAN SCOLIOSIS KHATEREH HAJIZADEH (B E, Isfahan University of Technology, Isfahan, Iran) (M.S., Isfahan University of ... of variables and parameters (as compared to Lagrange method), and availability of many efficient algorithms to calculate the partial derivatives (compute veloc...

Ngày tải lên: 30/09/2015, 06:15

167 566 0
INVESTIGATION OF a LYSIMETER USING THE SIMULATION TOOL siwapro DSS AND ADAPTATION OF THIS PROGRAM TO VIETNAMESE REQUIREMENTS

INVESTIGATION OF a LYSIMETER USING THE SIMULATION TOOL siwapro DSS AND ADAPTATION OF THIS PROGRAM TO VIETNAMESE REQUIREMENTS

... 13: Average value of phenol solubility in water 51 Table 14: Solubility of Naphthalene and Anthracene at 20oC 52 o Table 15: Comparison of experimental data and literature data of Antharacene at ... standard deviation, deviation coefficient and confident interval The standard deviation of a sample is a measure of how widely values are dispersed from the average value...

Ngày tải lên: 03/11/2015, 14:21

72 667 0
Immersive simulation games a case study of learning in a 3d multi user virtual environment

Immersive simulation games a case study of learning in a 3d multi user virtual environment

... virtual learning environment in the form of a simulation game, using the serious games concept in a 3dimensional multi- user virtual environment The design of the game, based on a real life case study, ... critical thinking that was challenging to achieve in traditional methods of learning Students’ behaviour was found to be generally neutral or positiv...

Ngày tải lên: 02/10/2015, 17:14

106 414 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf

Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf

... BUSINESS WATER FOOTPRINT ACCOUNTING: A TOOL TO ASSESS HOW PRODUCTION OF GOODS AND SERVICES IMPACTS ON FRESHWATER RESOURCES WORLDWIDE P.W GERBENS-LEENES1 A. Y HOEKSTRA1,2 MARCH 2008 VALUE OF WATER ... 27 Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater r...

Ngày tải lên: 06/03/2014, 21:20

46 959 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

... more clinical and statistical cohesive set together rather than existing as separate scales For the same reasons, three domains (physical comfort, technical aspects of care, coordination of care) ... JC, AJT and JH were involved in guiding the study including the design and coordination All authors contributed to the interpretation of data and writing of the manuscript A...

Ngày tải lên: 20/06/2014, 15:20

8 493 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

... detect any improvements in research capacity (We emphasize the point that the tool is meant to explore research capacity rather than performance) Thus, an advantage of a structured tool over ... of the tool The self-assessment tool 'Is research working for you? A self-assessment tool and discussion guide for health services management and policy...

Ngày tải lên: 11/08/2014, 05:21

9 506 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

... tool for organizations to evaluate their ability to use research findings The Canadian Health Services Research Foundation originally developed the tool The mission of the foundation is to support ... research findings Development of the tool The self-assessment tool 'Is research working for you? A self-assessment tool and discussion...

Ngày tải lên: 11/08/2014, 16:20

9 412 0
A case study of learning in a 3d multi user virtual environment

A case study of learning in a 3d multi user virtual environment

... virtual learning environment in the form of a simulation game, using the serious games concept in a 3dimensional multi- user virtual environment The design of the game, based on a real life case study, ... with a myriad of activities such as socializing, entertainment and learning (Hodge, World of Warcraft is a commercial massively multiplayer online ro...

Ngày tải lên: 09/10/2015, 11:06

106 458 0
Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

... WI, USA) A molar ratio between 1.7 and 2.2 mol of Cy3 per mole of saporin was incorporated The cytotoxicity of the Cy3 saporin was assayed and was unchanged as compared to the native saporin, ... holotoxin and the A chain alone [10–12] Thus, the catalytic domains of different bacterial and plant protein toxins, including ricin [8], PEA [2,3] cholera t...

Ngày tải lên: 23/03/2014, 15:21

13 389 0
báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

... involved in QI activities The team’s main tasks are described in a protocol and include formulating a QI action plan, monitoring of performance using the feedback reports, and initiating and evaluating ... this article as: van der Veer et al.: Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the...

Ngày tải lên: 10/08/2014, 11:20

10 421 0
Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc

Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc

... importance as the guardian of the cell cycle and its clinical relevance in human cancers, structural and thermodynamic understanding of the mechanisms of action of the Rb protein is far behind that of ... denote the position of FITC moieties (B) Association of E7( 1-40) and RbAB at 200 nM E7( 1-40) (C) Association of E7( 1-40) and the RbAB domain at...

Ngày tải lên: 22/03/2014, 21:20

16 405 0
Research report: "To study the effect of substituents on the properties of aniline by the method of approximate quantum AM1" pps

Research report: "To study the effect of substituents on the properties of aniline by the method of approximate quantum AM1" pps

... Correlation of the dipole moment with the Hammett constants of the substituents It is evident from the table II that electron-donating substituents on the phenyl ring increase the pKa of anilines ... Correlation of QN with the Hammett constants of the substituents According to the table 2, electron-donating substituents decrease the dipole moment of c...

Ngày tải lên: 23/07/2014, 13:21

6 375 0
Báo cáo y học: " “pp65 antigenemia and real time polymerase chain reaction (PCR) based-study to determine the prevalence of human cytomegalovirus (HCMV) in kidney donors and recipients with follow-up studies.”" pptx

Báo cáo y học: " “pp65 antigenemia and real time polymerase chain reaction (PCR) based-study to determine the prevalence of human cytomegalovirus (HCMV) in kidney donors and recipients with follow-up studies.”" pptx

... Madhavan et al.: “pp65 antigenemia and real time polymerase chain reaction (PCR) based-study to determine the prevalence of human cytomegalovirus (HCMV) in kidney donors and recipients with follow-up ... reported among asymptomatic and symptomatic patients respectively [11] The utility of the real time PCR technique for HCMV...

Ngày tải lên: 12/08/2014, 02:20

7 399 0
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx

Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx

... maturation of DCs [8,16,54,63] Considering the up-regulatory effect of NF-κB with regard to HIV-1 transcription and the potent induction of this transactivator by TLR2 stimulation, we thought that ... capturing HIV-1 at sites of viral entry into the body and transferring viruses to CD4+ T cells, immature mDCs may be critical to the process of HIV-1 transmiss...

Ngày tải lên: 12/08/2014, 23:20

16 288 0
w