a biological tool to translate the mechanisms of heart development
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...
- 8
- 492
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 506
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 412
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...
- 20
- 643
- 0
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx
... support DATA MANAGEMENT Data quality and access, as well as appropriate standards for data reporting and archiving, will be integral components of a successful program to enhance the value of data collected ... priorities and goals for the National Ocean Acidification Program The FOARAM Act calls for the development of a detailed, 10-year strategic plan for the National Ocean Acidification Program; while the ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite...
- 163
- 400
- 0
The Weapons Mix Problem - A Math Model to Quantify the Effects of Internetting of Fires to the Future Force pptx
... The IOF Allocator as Part of a Suite of Analytical Tools xii Internetting of Fires Is the Dynamic Pooling of Resources Enabled by C4ISR The IOF Allocator as Part of the WMT Suite of Analytical ... brought into a variety of programs for analysis The details and full description of the mathematical model at the heart of the IOF Allocator and its implementation are included in Appendixes A and ... focused on the development of a tool (the IOF Allocator) that assigns shooters to targets based on available information The tool would be one of several necessary to facilitate the decisionmaking...
- 48
- 369
- 0
Báo cáo hóa học: " A Proxy Architecture to Enhance the Performance of WAP 2.0 by Data Compression" ppt
... simulator and injecting traffic from the simulator into the live network after the traffic has been subject to appropriate delays and losses Due to the header added in ns-2 emulation, the Ethernet maximum ... configurations are evaluated by comparing the ATDiffs, which are the WATs of other configurations minus the WAT of uncompressed WAP 2.0 ATDiff = ATotherconf − ATnocomp WAP = WATotherconf − WATnocomp WAP 3.3 ... Telecommunications Engineering, and Associate Head for Graduate A airs His research interests are in the areas of architectural and protocol design and performance analysis for computer and telecommunication...
- 10
- 432
- 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx
... Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile duct carcinoma: a ... Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative hemihepatic portal vein embolization Hepatology 2001, 34:267-272 Wakabayashi ... Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number not for citation...
- 7
- 384
- 0
Báo cáo khoa học: "A pilot study to assess the feasibility of evaluation of markers of response to chemotherapy at one day & 21 days after first cycle of chemotherapy in carcinoma of breast: a prospective non-randomized observational study" potx
... had a plateau to nearly same level at 21 days (Figure 2c) Caspase-3 values peaked at 24–48 hours before falling to near baseline levels at 21 days after the first chemotherapy with nearly similar ... significant (p = ns) We faced problems using Caspase-3 to evaluate the apoptotic index, as this terminal enzyme of the apoptotic cascade is cytoplasmic in location This led to a diffuse staining of ... to travel great distances to seek medical care We chose to evaluate three biomarkers, namely Ki-67 (marker of proliferation), Bcl-2 and Caspase-3 (anti- and pro-apoptotic markers) as data exist...
- 11
- 393
- 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and ... metalloproteinase (96-kd gelatinase B) in human rheumatoid arthritis Arthritis Rheum 1996, 39:1576-1587 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... La Fondation Armand-Frappier and the Canadian Arthritis Network 16 17 References Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular...
- 10
- 494
- 0
Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps
... occur at nearly the same time The angular direction of a phasor indicates the phase relationship between light and activity for an individual Greater amounts of activity near the onset of circadian ... indicate prolonged times of rest and, usually, darkness Although many analyses of the activity and of the transformed CS data are possible, the data in Figure were used to develop a quantitative ... perhaps reflecting a true continuum of the degree of circadian behavioral-entrainment among individuals The data from the rats in Figure 9b also show a clear and statistically significant separation,...
- 14
- 522
- 0
báo cáo khoa học: " A randomized trial to assess the impact of opinion leader endorsed evidence summaries on the use of secondary prevention strategies in patients with coronary artery disease: the ESP-CAD trial protocol" doc
... cholesterol; CAD = coronary artery disease; AMI = acute myocardial infarction; ACS = acute coronary syndrome; CV = cardiovascular; Atorva = atorvastatin; Prava = Pravastatin; Simva = simvastatin the EURopean ... atherosclerosis)[81] All of the faxes (APPROACH HeartView diagrams and the one page statement) will be generated and sent automatically using a software program that has been developed for this trial and embedded ... care physician, along with the APPROACH HeartView Diagram, in the same manner as described above Physicians of control patients (usual care) will receive a fax containing only the APPROACH Heartview...
- 12
- 396
- 0
Báo cáo y học: "Head repositioning errors in normal student volunteers: a possible tool to assess the neck''''s neuromuscular system" doc
... position The CA-6000 linkage measures head position relative to the base affixed at the first thoracic vertebra Matching Lucite blocks, one attached to the headband of the CA-6000, and the other attached ... Mathsoft Inc, Cambridge, MA) Variables of primary interest were the average head orientation at the target position for seconds before deconditioning and the average head orientation at the target ... CA) was used to measure head position and motion with respect to the upper thoracic spine in the cardinal planes: sagittal (AP-flexion), frontal (lateral flexion), and horizontal (rotation) The...
- 7
- 211
- 0
Báo cáo y học: " A statistical approach to estimating the strength of cell-cell interactions under the differential adhesion hypothesis" pptx
... models These models are dual to the centric models [15,16], and they have the same characteristics in terms of realism and computational behavior The fourth class of models, called sub-cellular lattice ... configuration obtained after 100,000 iterations with θ = 10 (b) The decrease of the energy as a function of the iteration steps (c) The evolution of the accpetance rate as a function of the iteration steps ... and that white cells may ˆ be surrounded by black cells The estimated value θ was Experimental data Estimation of the adhesion strength was also performed on a real data example We used data from...
- 13
- 326
- 0
LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN
... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...
- 4
- 465
- 0
TOWARDS a CONSISTENT CHRONOLOGY TO EXPLAIN THE EVOLUTION OF THE RIBOSOME
... first, the twenty specific amino acids specifically attach to the transfer RNA (tRNA) molecules via covalent linkage with the help of aminoacyl-tRNA synthetases (aaRSs), the catalyst of the aminoacylation ... common to archaea and bacteria (Hartman and Smith 2010) In the translational process, the initiation factor in bacteria, IF2, and their archaeal homologs, the EF1, EF2, aeIF5b and aeIF2 bring the ... The aaRSs are multi-domain proteins, in which only one domain works as the catalytic domain, the others are capable of anticodon binding, aaRS-tRNA stabilization and tRNA deacylation Among them,...
- 199
- 473
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ... and accounts for 75% to 85% of the total yearly rainfall, whereas the dry season lasts up to 6 months, from February to July and occupies only 15‐25% of the total rainfall. ... negative impacts, especially in the future, when the province has the plan to develop the aquaculture to be the key sector of local economics [6]. A re a (h e c ta r s ) January and ...
- 13
- 487
- 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... F, Vieta E, Martínez-Arán A, Garcia-Garcia M, Reinares M, Torrent C, Goikolea JM, Banús S, Salamero M: Spanish version of a scale for the assessment of mania: validity and reliability of the Young ... Juan José Uriarte, and Fermín Mayoral for their contribution in the linguistic validation Author details Department of Psychiatry, Hospital Universitario de Salamanca, Salamanca, Spain 2Department ... adaptation of the TOOL questionnaire Forward/backward translations of the original TOOL questionnaire were completed by expert translators Firstly, three independent Spanish experts translated the...
- 8
- 476
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25