a new tool to forecast internal composition of its demand
Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx
... clearly related to clinical experience This study provides evidence in favour of SCT as a reliable and valid tool to evaluate the clinical reasoning of radiation oncology residents The use of ... contributed to acquisition of data and revised the manuscript BC contributed to conception and design, analysis and interpretation of data and has been involved in draft- Page of (page number ... used To evaluate the capacity to significantly discriminate the scores of the three groups, the non-parametric KruskallWallis test was applied The non-parametric Mann-Whitney test was used to assess...
- 6
- 392
- 0
Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps
... nocturnal species are used almost exclusively as animal models in this research, a method needs to be established to relate actual circadian light and dark exposures in humans to parametrically ... occur at nearly the same time The angular direction of a phasor indicates the phase relationship between light and activity for an individual Greater amounts of activity near the onset of circadian ... of rats than in the dayshift nurses Clearly if cross-species comparisons are to be made, additional investigations need to be undertaken of actual light exposures and of alternative behavioral...
- 14
- 522
- 0
Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps
... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison of ... and easy methods to estimate tree quality Hakkila [12] and Hakkila et al [13] used similar indices to ASIX to estimate branch amount Table II Calculation of branch thickness with a special Asix ... characterised by a subatlantic climate with an annual precipitation of 700 mm and a mean annual temperature of 14.5 °C The soil is a poor sandy pleistocene podsolic cambisol (FAO) The plots have...
- 8
- 315
- 1
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... central concern of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...
- 44
- 1,746
- 7
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
... unwillingness of managers or staff to accept change is often rooted in a culture of inertia and bureaucratic thinking Failure or inability of an agency’s management or staff to adapt to changed conditions ... Defense, and Homeland Security; the Federal Aviation Administrations (FAA); the National Aeronautics and Space Administration (NASA); and the White House Office of Science and Technology to plan the ... senior administrators and be great enough to send a message that a change is absolutely necessary Interested parties then come together to formulate a policy of transformation and to hammer out a...
- 288
- 2,415
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...
- 12
- 616
- 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc
... front to assess any gaps and weaknesses in data-collection protocols Collaboration with relevant government agencies will also be necessary to gain access to administrative data, such as Medicaid ... political risk that the government fails to appropriate funds to pay investors by working to secure authorization of a multi-year contract sIBs sHould Have BIPaRtIsan aPPeal as tHeY sHIFt FInancIal ... records Administrative data will allow evaluators to assess program participants’ outcomes relative to a comparison group or a historical baseline Where programs affect multiple government agencies,...
- 36
- 262
- 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
... companies often consist of a number of units For example, a company can have operations (e.g factories) at various locations Or a company may have separate divisions at one location For the purpose of ... vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water footprint analysis A. Y Hoekstra – July 2007 24 A river basin ... lack access to improved water and sanitation? (v) How many of your suppliers are in water scarce areas now? And (vi) How many will be in 2025? The Global Water Tool calculates water withdrawal...
- 46
- 959
- 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... aspects of meaning construction in natural language The MIT Press Charles J Fillmore 1968 The case for case Holt, Rinehart and Winston, New York Satoru Ikehara, Masahiro Miyazaki, Satoshi Shirai, Akio ... parsing system In Proceedings of the First International Conference on Language Resources ~ Evaluation, pages 719724 Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto...
- 8
- 553
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... Council of Canada [1] Reduplication is a word formation process involving the repetition of a word or a part of a word As an example, in Warlpiri there is a process of nominal reduplication to form ... ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example illustrates a number of instances of phonological...
- 8
- 522
- 0
Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt
... suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the translation task ... only As regards the second aim, the TCj which accompany a current word may reveal that it could be a possible indicator of a main clause, or subordinate clause, or a phrase If such is the case, an ... possible, starters of main clauses, (4) actual, or possible, starters of subordinate clauses, (5) actual, or possible, predicates for each clause, and (6) actual, or possible, phrase starters As a result...
- 18
- 701
- 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx
... Tuula, Susanna, Katri, and Juha as an integral part of my intellectual welfare I have had the privilege to be able to attend several international conferences, to meet new colleagues, and to see some ... Monografia Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t) ... lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion kasvuun kitosaanin läsnä ollessa, mutta myös kovalenttinen sitoutuminen on todennäköisesti...
- 89
- 701
- 1
a new introduction to old norse part iii glossary and index of names
... B:4; flann dag allan all that day VI:286, VIII:121; flenna dag on this day, today VI:90; annan dag eptir the next day VIII:111; annars dags tomorrow X:106; nƒkkura daga a few days VII B:49; dat sg ... (cf Attila) Atli enn mjóvi m XIX:6, 15, 24 Cf Landnámabók, ÍF I 370–76, and Flóamannasaga, ÍF XIII 231–45 atmælasamr adj given to finding fault, abusive XXI:12 atrei› f ride XXVI A: 1 atseta f ... ver a at bana with dat cause the death of someone X:153, XIX:77 (understand of him); flat sé fleira bani it would be (lead to) their death XXVI B:66; flat er várr bani that will lead to our deaths...
- 319
- 404
- 0
báo cáo hóa học: "Learning to perform a new movement with robotic assistance: comparison of haptic guidance and visual demonstration" pptx
... the hand path evolved systematically toward an attractor path during "forgetting" then this measure should have decreased systematically (as the hand path was drawn toward the attractor path) ... 2001:14-17 Marayong P, Okamura AM: Speed-accuracy characteristics of human-machine cooperative manipulation using virtual fixtures with variable admittance Hum Factors 2004, 46:518-532 Bettini A, Marayong ... the recall phase of each cycle suggested that the increase in trajectory error was due to a systematic and progressive distortion in the hand path, rather than to a random pattern of tracing errors...
- 10
- 405
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access A new instrument to pot
... Table 7: Paired sample test and Spearman Rank correlation coefficients between nurses and physicians related to the same patient at the same day (22 pairs) Factor – Communication – Negative Affect ... that these factors can be regarded as a useful approach to describe the well-being in these patients 10 11 12 Barofsky I: Cognitive aspects of quality of life assessment in: Quality of life and ... psychosocial model of "person-centred care" which provides detailed observational ratings covering aspects of articulation, feeding, social withdrawal, passive engagement, walking and a number of indicators...
- 8
- 262
- 0
báo cáo hóa học: " The laval questionnaire: a new instrument to measure quality of life in morbid obesity" docx
... questionnaire to be used in clinical trials Methods The Laval Questionnaire The Laval Questionnaire is a 44-item questionnaire that is meant to be used as an evaluative instrument - that is, as a clinical ... the standardized response mean that compares the magnitude of change with its standard deviation [26] The standardized response mean represents an intuitive estimate of the “signal -to- noise ratio” ... the most important measurement property of a quality -of- life questionnaire used in clinical trials is its ability to reveal a minimal clinically significant change in a particular context This...
- 8
- 460
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the scales Finally, although ... experiences of relapse management, and a preliminary 154item questionnaire Eight clinically relevant areas emerged: access to care, coordination of care, physical comfort, technical aspects of care, ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar...
- 8
- 492
- 0
A new material to reduces curing time and improve curing reproducibility of lead–acid batteries doc
... determine the phases present using a Rigaku Miniflex X-ray analyzer with software adapted for calculation A summary of the data obtained from trials carried out with two automotive battery manufacturers ... images were also obtained at a magnification of 3000 to determine crystal size In some cases, BET specific surface-area and porosity measurements were made Automotive battery plate paste-mixing and ... free-lead oxidation in both positive and negative plates - increases the initial capacity of industrial batteries - increases the cold-cranking amperes, reserve capacity and 20 h rate capacity of automotive...
- 7
- 729
- 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... 178:510-517 Page of 20 Colom F, Vieta E, Martínez-Arán A, Garcia-Garcia M, Reinares M, Torrent C, Goikolea JM, Banús S, Salamero M: Spanish version of a scale for the assessment of mania: validity and ... Henares, Coslada, Madrid, Spain 3BAP Health Outcomes Research, Oviedo, Spain 4Value Demonstration Unit, AstraZeneca Medical Department, Madrid, Spain 5Neuroscience Area, AstraZeneca Medical Department, ... Fermín Mayoral for their contribution in the linguistic validation Author details Department of Psychiatry, Hospital Universitario de Salamanca, Salamanca, Spain 2Department of Psychiatry, Hospital...
- 8
- 476
- 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx
... Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile duct carcinoma: a ... Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative hemihepatic portal vein embolization Hepatology 2001, 34:267-272 Wakabayashi ... Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number not for citation...
- 7
- 384
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25