Detection, formation and reactivity of tetravalent lead corrosion product (pbo2) and its role in water quality in drinking water distribution system
... DETECTION, FORMATION AND REACTIVITY OF TETRAVALENT LEAD CORROSION PRODUCT (PbO2) AND ITS ROLE IN WATER QUALITY IN DRINKING WATER DISTRIBUTION SYSTEM NAME: ZHANG YUANYUAN ... critical role in regulating lead contamination in drinking water, a precise and fast method for its detection is required to determine its abundance in drink...
Ngày tải lên: 30/09/2015, 06:15
... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regi...
Ngày tải lên: 14/02/2014, 19:20
... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... interface formed in the tetramer would disrupt copper < /b> binding < /b> Inhibition of amyloid fibril formation by < /b> stefin < /b> B in presence of copper < /b> The mechanism of amyloid fibril formation of cystatins is being studied ... histidine residues are central to copper < /b> binding < /b> in many proteins they probably form part of the copper < /...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx
... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human A...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx
... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt
... Shin-ichiro and Wakao, Takahiro (1992) Metonymy: reassessment, survey of acceptability, and its treatment in a machine translation system Locating 1.1 Container for Content Dave drank the glasses The ... Metonymic interpretation and associative processes in natural language In Exxon has raised its price again Washington is insensitive to the needs of the pe...
Ngày tải lên: 23/03/2014, 20:20
Báo cáo y học: "Downregulation of protein disulfide isomerase in sepsis and its role in tumor necrosis factor-alpha release" pps
... molecular chaperones in the folding of oxidized proteins Refolding of colloidal thyroglobulin by protein disulfide isomerase and immunoglobulin heavy chain-binding protein J Biol Chem 2001, 276:21337-21342 ... Mechanism of hepatocellular dysfunction during early sepsis: key role of increased gene expression and release of proinflammatory cytokines tumor necrosis...
Ngày tải lên: 13/08/2014, 11:22
MECHANISM OF TISSUE TRANSGLUTAMINASE UPREGULATION AND ITS ROLE IN OVARIAN CANCER METASTASIS
... v ABSTRACT Liyun Cao MECHANISM OF TISSUE TRANSGLUTAMINASE UPREGULATION AND ITS ROLE IN OVARIAN CANCER METASTASIS Ovarian cancer (OC) is a lethal disease due to metastasis and chemoresistance Our ... activating NF-κB complex, which leads to increased cell invasiveness in vitro and tumor metastasis in vivo The N-terminal fibronectin (FN) binding domain o...
Ngày tải lên: 24/08/2014, 10:58
REGULATION OF CHOP TRANSLATION IN RESPONSE TO eIF2 PHOSPHORYLATION AND ITS ROLE IN CELL FATE
... N-terminal domain of HRI and in an insert region in the protein kinase domain of HRI (63) Heme, in the presence of iron, binds to α and β globin chains in ratio of 1:2:2, respectively In response to iron ... Palam REGULATION OF CHOP TRANSLATION IN RESPONE TO eIF2 PHOSPHORYLATION AND ITS ROLE IN CELL FATE In response to different en...
Ngày tải lên: 24/08/2014, 12:32
Characterization of helicobacter pylori y glutamyl transpeptidase and its role in pathogenesis
... assay 57 3.5.2 Growth of different H pylori strains 57 3.5.3 Inhibitory effect of serine borate complex on H pylori GGT activity 58 3.5.4 Stimulatory effect of GSH and glycyl-glycine on H pylori ... activity of H pylori 100 4.2.2.2 GSH enhances the GGT acitivity of H pylori 101 4.2.2.3 Effects of GGT inhibitor and enhancer on the growth of H pylori 102 4.3 Sequen...
Ngày tải lên: 12/09/2015, 09:55
Characterization of rab22b, an astroglia enriched rab GTPase, and its role in golgi and post golgi membrane traffic
... CHARACTERIZATION OF RAB2 2B, AN ASTROGLIAENRICHED RAB GTPASE, AND ITS ROLE IN GOLGI AND POST -GOLGI MEMBRANE TRAFFIC NG, EE LING B APP SC (HONS) (QUEENSLAND UNIVERSITY OF TECHNOLOGY) ... 1.1 An overview of Rab GTPases and membrane trafficking The enormous flux of membrane traffic within a cell at any point of its existence necessitates stri...
Ngày tải lên: 12/09/2015, 09:55
A novel membrane pool of protein kinase c and its role in mammalian cell signaling
... extracellular ligand-binding domain and an intracellular catalytic or enzyme-binding domain The great majority of the receptors are themselves protein kinases or are associated with kinases Binding ... discovered kinases that catalyze the phosphorylation of hydroxyamino acids All of the known protein kinases including tyrosine kinases share a related catalytic domain of about...
Ngày tải lên: 12/09/2015, 21:10