Design of functional polymeric micelles as a carrier for anticancer drug delivery
Design of functional polymeric micelles as a carrier for anticancer drug delivery
... interaction for intracellular uptake after the nanocarriers reach the target site from blood circulation and extravasation There are advantages and drawbacks for each of this strategy that will ... and Y Y Yang, “Advanced Materials for Co -Delivery of Drugs and Genes in Cancer Therapy,” Advanced Healthcare Materials (2012) 373-392 C Yang*, A Bte Ebrahim Attia*, J.P.K Tan*, X Ke,...
Ngày tải lên: 30/09/2015, 06:07
Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot
... in asimple feed delivery system for vaccination of village chickens ACIAR proceedings Canberra Australia 1992, 39:86-91 OIE: Newcastle disease: Manual of standard for diagnostic tests and vaccines ... observed a drop in titer to the vaccine for birds in that group The highest HI titer result was obtained from soaked cracked maize carrier followed by soaked maize...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel...
Ngày tải lên: 06/03/2014, 09:22
Application of HCRSV protein cage for anticancer drug delivery
... hydrocarbons phosphate buffered saline protein cage doxorubicin-loaded protein cage protein cages loaded with FD protein cages loaded with PAA protein cages loaded with PSA photon correlation ... targeting platform for anticancer drug delivery, and that it should be further evaluated to realize this potential XI List of Tables Table Page 1-1 Amino acid sequence of the...
Ngày tải lên: 11/09/2015, 14:22
Tài liệu The Design Of Functional Programs - A Calculational Approach doc
Ngày tải lên: 19/02/2014, 14:20
Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf
... relations of a sentence But what about the logical relations? Recall that each clause has a unique head end that the functional features of each phrase are identified with those of its head For ... property that the functional features of each phrase are identified with those of its head The head category of a phrase is characterized by d~e assignment of the trivial...
Ngày tải lên: 24/03/2014, 05:21
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx
... Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer Nanoscale Res ... reduction Characterization of Gold Nanotriangles Experimental Details Isolation of Endophytic Aspergillus clavatus The host plant Azadirachta indica...
Ngày tải lên: 21/06/2014, 08:20
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic a...
Ngày tải lên: 16/09/2015, 17:10
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"
... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocyt...
Ngày tải lên: 25/10/2012, 11:10
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... interest students in listening lessons That is the reason why this paper is made a study of using English songs as a kind of supplementary material in teaching listening skill to first year non- major ... OF USING SONGS AS A SUPPLEMENTARY MATERIAL IN TEACHING LISTENING FOR THE FIRST- YEAR NON- MAJOR STUDENTS OF ENGLISH...
Ngày tải lên: 29/01/2014, 10:33
Tài liệu The Value of the Case Study as a Research Strategy doc
... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... underlying the case study itself is of a holistic nature Case studies may either focus on a single case or use a number of cases: A single case may...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is...
Ngày tải lên: 07/03/2014, 10:20
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
... types of costing method such as: traditional or absorption costing method, variable costing method, throughput costing method, and ABC costing method Changes in business environments requires a better ... variable costing method was used as the only and easiest way to calculate the costs This is because it is easy to accountants as well as managers and...
Ngày tải lên: 13/03/2014, 14:19