Design of functional polymeric micelles as a carrier for anticancer drug delivery
Design of functional polymeric micelles as a carrier for anticancer drug delivery
... interaction for intracellular uptake after the nanocarriers reach the target site from blood circulation and extravasation There are advantages and drawbacks for each of this strategy that will ... and Y Y Yang, “Advanced Materials for Co -Delivery of Drugs and Genes in Cancer Therapy,” Advanced Healthcare Materials (2012) 373-392 C Yang*, A Bte Ebrahim Attia*, J.P.K Tan*, X Ke, S Gao, J L ... vascular endothelial cell-cell junctions wider to allow for more extravasation of nanoparticles [118] Grafting a targeting ligand onto the surface of nanocarriers on the other hand grants enhanced...
- 185
- 1,116
- 0
Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot
... in asimple feed delivery system for vaccination of village chickens ACIAR proceedings Canberra Australia 1992, 39:86-91 OIE: Newcastle disease: Manual of standard for diagnostic tests and vaccines ... observed a drop in titer to the vaccine for birds in that group The highest HI titer result was obtained from soaked cracked maize carrier followed by soaked maize husk The maize offal was used as a ... fifth group was made up of maize offal which was obtained by soaking the entire maize grain in water for four days after which it was ground and sieved The sieved out part (offal) was then sun...
- 5
- 285
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr of ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency...
- 10
- 434
- 0
Application of HCRSV protein cage for anticancer drug delivery
... hydrocarbons phosphate buffered saline protein cage doxorubicin-loaded protein cage protein cages loaded with FD protein cages loaded with PAA protein cages loaded with PSA photon correlation ... targeting platform for anticancer drug delivery, and that it should be further evaluated to realize this potential XI List of Tables Table Page 1-1 Amino acid sequence of the HCRSV coat protein, which ... yields of to mg of purified HCRSV per 100 g of leaves This method provided a stable source of HCRSV for subsequent experimentation The HCRSV capsids were disassembled by incubation with M of urea...
- 218
- 516
- 0
Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf
... relations of a sentence But what about the logical relations? Recall that each clause has a unique head end that the functional features of each phrase are identified with those of its head For ... property that the functional features of each phrase are identified with those of its head The head category of a phrase is characterized by d~e assignment of the trivial ft~%ctional-equation and by ... nature, namely scyclic graphs The semlntin structures are the result of a translation procedure which is based on the association of formulas of intensional logic to the semantic forms appearing...
- 6
- 476
- 0
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx
... Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer Nanoscale Res ... reduction Characterization of Gold Nanotriangles Experimental Details Isolation of Endophytic Aspergillus clavatus The host plant Azadirachta indica A Juss was surveyed, and samples were randomly collected ... Vigneshwaran N, Ashtaputre NM, Varadarajan PV, Nachane RP, Paralikar KM, Balasubramanya RH: Mat Lett 2007, 61:1413 17 Bhainsa KC, D’Souza SF: Coll Surf B Biointer 2006, 47:160 18 Shankar SS, Ahmad A, ...
- 7
- 261
- 0
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic acid CK1 casein kinase CK2 casein kinase ... interacting proteins Using the former approach, the catalytic α subunit of protein kinase CK2 (formerly known as casein kinase 2) was isolated from rat brain extracts The direct associations of CK2 with...
- 182
- 480
- 0
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"
... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocytes suspended in PBS, and pravastatin-loaded ... Koitabashi Y, Kumai T, Matsumoto N, Watanabe M, Sekine S, Yanagida Y, Kobayashi S Orange juice increased the bioavailability of pravastatin, 3-hydroxy-3-methylglutaryl CoA reductase inhibitor, in...
- 9
- 829
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... interest students in listening lessons That is the reason why this paper is made a study of using English songs as a kind of supplementary material in teaching listening skill to first year non- major ... OF USING SONGS AS A SUPPLEMENTARY MATERIAL IN TEACHING LISTENING FOR THE FIRST- YEAR NON- MAJOR STUDENTS OF ENGLISH AT PHUONG DONG UNIVERSITY 2.1 Hypothesis: As presented above, this study was ... such as filling in the blanks 3.3 IMPLICATION IN USING ENGLISH SONGS IN TEACHING LISTENING SKILL 3.3.1 How to use songs as supplementary materials? As said above the main purpose for using songs...
- 39
- 1,125
- 3
Tài liệu The Value of the Case Study as a Research Strategy doc
... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... underlying the case study itself is of a holistic nature Case studies may either focus on a single case or use a number of cases: A single case may form the basis of research on typical, critical or ... in an Administrative Science Quarterly article titled 'Qualitative data as an attractive nuisance' that research based upon case study was unlikely to transcend story-telling Is case study a valid...
- 15
- 587
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG ... ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible...
- 13
- 563
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease Ann Neurol 36, 747–751 Modulation of metal availability for treating AD 81 Maynard CJ, Cappai R, Volitakis I, Cherny RA,...
- 9
- 634
- 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
... types of costing method such as: traditional or absorption costing method, variable costing method, throughput costing method, and ABC costing method Changes in business environments requires a better ... variable costing method was used as the only and easiest way to calculate the costs This is because it is easy to accountants as well as managers and shareholders understand the directions of ... A STUDY ON IMPACTS AND EFFECTIVENESS OF ABC COSTING METHOD AS A COST EFFECTIVE MEASUREMENT IN COAL INDUSTRY BY NGUYEN THI THU HUYEN APRIL, 2011 Supervisor: Ms Nguyen Van Anh Abstract: According...
- 64
- 512
- 0
Từ khóa: micelles the multifunctional nanocarrier for colloidal drug deliverythe optic lamina of fast flying insects as a guide to neural circuit designmeaning of the maltese cross as a firefighteralgae as a feedstock for biofuels an assessment of the current status and potential for algal biofuels productionbiological evolution of the saussurean sign as a component of the language acquisition deviceproblems of using english language as a medium of business communication in nigeriause of atomic force microscopy as a diagnostic tool to identify orthopoxvirusproblems of using english language as a medium of business communicationapplication of atomic force microscopy as a nanotechnology tool in food scienceadvantages of using case study as a teaching methodthe future of human resource management as a professionclinicians employers policymakers and others make informed decisions about the provision of health care services this report is intended as a reference and not as a substitute for clinical judgmentthe legal structure of the european union as a union of statestotal public expenditure on tertiary education as a percentage of public expenditure and as a percentage of gdpsite directed mutagenesis as a tool for unveiling mechanisms of bacterial tellurite resistanceBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ