A sketch based system for infra structure presentation

... understand that gesture operations are not omnipotent, and have limitations [3] We are to solve the infra- structure presentation problem with a sketch- based interface, which is a manual way Efforts ... generate precise 3D models and support high level editing Compared to industrial CAD packages, sketch based interfaces fast conceptualize ideas and communicate information, bu...

Ngày tải lên: 26/09/2015, 09:56

... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information ... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web-based model make it portabl...

Ngày tải lên: 27/10/2012, 16:40

... [Online] Available: http://gunpowder.stanford.edu/˜laik/projects/adhoc/mitigating.pdf [5] L Buttyan and J P Hubaux, “Enforcing service availability in mobile ad-hoc WANs,” in IEEE/ACM Workshop on Mobile ... unicast case As route-discovery broadcast can be viewed as a special case of multicast, this approach can also be applied to multicast if multicast is not frequently used in the s...

Ngày tải lên: 15/03/2014, 04:20

... the additions and changes that have been made to the facilities that are available to programmers The original UNIX system that runs on the PDP-11† has simple and elegant file system facilities File ... block is allocated and the * A program may be overwriting data in the middle of an existing file in which case space would already have been allocated SMM:05-6 A Fast File Syst...

Ngày tải lên: 12/09/2012, 14:16

... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... loading areas, which were classified as public land use in the SCAG data and USGS classification system Recreational facilities including parks were also classifie...

Ngày tải lên: 05/09/2013, 09:08

... calculate the gap matrices For a given gap matrix, we have to consider all the different ways that its diagram can be assembled using one or two matrices at a time (Again, Feynman diagrams are ... folding and for RNA structural alignment and structural similarity searches The Inside and CYK dynamic programming algorithms used for SCFGbased structural alignment are fundamentall...

Ngày tải lên: 12/01/2014, 22:07

... stage To accomplish this, Table summarizes the KM practices in ERP implementation process A KNOWLEDGE MANAGEMENT SYSTEM FOR ERP IMPLEMENTATION Knowledge management systems (KMS) refer to a class ... The ERP change in China: a resourcebase perspective Information Systems Journal 14: 153– 167 Jarrar Y 2002 Knowledge management: learning for organizational experi...

Ngày tải lên: 16/01/2014, 16:33

... Systems, ed P Jacobs, Lawrence Erlbaum Associates, Hillsdale, NJ, pp 13-33 Kameyama, M (1992) "The Syntax and Semantics of the Japanese Language Engine", forthcoming In Mazuka, R., and N Nagai, ... is that when they are formulated loosely, as in the previous paragraph, they appear to conflict In particular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a...

Ngày tải lên: 20/02/2014, 21:20

... an operator, &, unique to SFG Formulas involving ~ are called e~tension formulas and they have a more complicated semantics For example, Dative has the following informal interpretation: Two distinct ... empty For c = , , k , for each Graph(hi) of Wc, add [ni, c - 1, c] to Se B Completions: For c = , , k, repeatedly until no more states can be added to Se: L e f t w a r d Completion:...

Ngày tải lên: 20/02/2014, 21:20

... LetsMT! platform is heterogeneous The majority of services run on Linux platforms (Moses, RR, data processing tools, etc.) The Web server and application logic services run on a Microsoft Windows platform ... services run on a Microsoft Windows platform The system hardware architecture is designed to be highly scalable The LetsMT! platform contains several machines with both continuou...

Ngày tải lên: 07/03/2014, 18:20

... correct for 2-planar dependency forests, neither of which existed in the literature before In addition, we have presented empirical results showing that the class of 2-planar dependency forests ... the parser will build a 2-planar dependency forest by using each of the stacks to construct one of its two planes The 2-planar transition system, shown in Figure 4, has configurati...

Ngày tải lên: 07/03/2014, 22:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

... information provided by these resources, examine the respective input and output formats, and state how the formats are integrated into a common data representation in order to access the information ... semantic representations The application is planned to be used in web experiments to acquire further data for alignment and to study specific effects in the generation of walking instru...

Ngày tải lên: 17/03/2014, 02:20

... Ishihara et al (Eur J Biochem 270) Here we examined the effects of SA on stress response in mammalian cells using a simple screening system, and revealed that SA is a potent Hsp inducer in mammalian ... expression of endogenous heat shock proteins such as Hsp1 0 5a and Hsp7 0 in various mammalian cells Enhancement of thermoresistance of cells...

Ngày tải lên: 17/03/2014, 10:20

... http://www.motherearthnews.com/Real-Food/2007-1001/Tests-Reveal-Healthier-Eggs.aspx#ixzz27LvkfgLn Other Benefits of Pastured Poultry • Ethical concerns • Appealing appearance of flock to customers You’re not just marketing a product, you are marketing a way of life! Pastured ... advanced feathering – use feathering as a guide for decreasing temperature as the amount of feathering...

Ngày tải lên: 17/03/2014, 10:20